Application of DNA tetrahedron in preparation of medicine for preventing and treating type 1 diabetes mellitus

A technology of type 1 diabetes and tetrahedron, applied in drug combination, metabolic disease, pharmaceutical formula, etc., can solve the problem of tFNAs treatment or prevention of type 1 diabetes that has not yet been seen, and achieve the effect of solving insufficient insulin secretion

Active Publication Date: 2021-08-06
SICHUAN UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] There are no reports on the treatment or prevention of type 1 diabetes with tFNAs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of DNA tetrahedron in preparation of medicine for preventing and treating type 1 diabetes mellitus
  • Application of DNA tetrahedron in preparation of medicine for preventing and treating type 1 diabetes mellitus
  • Application of DNA tetrahedron in preparation of medicine for preventing and treating type 1 diabetes mellitus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] The synthesis of embodiment 1tFNAs

[0038] 1. Synthesis method

[0039] Dissolve the four DNA single strands (S1, S2, S3, S4) in TM Buffer (10mM Tris-HCl, 50mM MgCl 2 , pH = 8.0), so that the final concentration of the four DNA single strands is 1000nM, mix well, heat quickly to 95°C and keep for 10 minutes, then quickly cool down to 4°C and keep for more than 20 minutes to obtain tFNAs. Synthesis schematic as figure 1 As shown in A.

[0040] The sequences of the four single strands (5'→3') are as follows:

[0041] S1:

[0042] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO. 1)

[0043] S2:

[0044] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTC AGACTTAGGAATGTTCG (SEQ ID NO. 2)

[0045] S3:

[0046] ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC (SEQ ID NO. 3)

[0047] S4:

[0048] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG (SEQ ID NO. 4)

[0049] 2. Identification

[0050] From the results o...

experiment example 1t

[0052] Experimental example 1 In vivo experiment of tFNAs preventing diabetes

[0053] NOD / ShiLtJ mice are a typical animal model for simulating type 1 diabetes. At week 4-5, lymphocytes appear around the islets, and then a large number of white blood cells enter the entire islets. Finally, the β-cells fail, insulin deficiency begins, and symptoms of diabetes appear. In females, pancreatic insulin drops significantly at about 12 weeks (male is a few weeks later than females), and blood sugar levels rise to greater than 2.50 mg / mL; 90% of pancreatic islet β cells are destroyed at 24-30 weeks, and the probability of females developing diabetes is 90% , males have a 50%-60% chance of developing diabetes.

[0054] In this experiment, female NOD / ShiLtJ mice were treated with tFNAs to evaluate the effect of tFNAs on preventing and inhibiting the progression of diabetes.

[0055] 1. Method

[0056] (1) 8-week-old female NOD / ShiLtJ mice were purchased and adaptively fed for one week. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a DNA tetrahedron in preparation of a medicine for preventing and treating type 1 diabetes mellitus, and belongs to the field of diabetes mellitus medicines. According to the application, a regulating effect of the DNA tetrahedron on immune cells is utilized, autoimmunity is inhibited, and occurrence and development process of type 1 diabetes mellitus is hindered from the source; in addition, the DNA tetrahedron and metabolites thereof are non-toxic and good in biocompatibility, so that the DNA tetrahedron has a good application prospect when being used for preparing the medicine for preventing and treating the type 1 diabetes mellitus.

Description

technical field [0001] The invention belongs to the field of diabetes-related drugs. Background technique [0002] Type 1 diabetes is the most common autoimmune disease. As an autoimmune disease, the immune pathogenesis of type 1 diabetes is mainly T cell-mediated attack on the insulin-secreting β cells in the islets. With the progress of this autoimmune process, the number of pancreatic β cells gradually decreases, and eventually Lead to severe lack of insulin secretion, resulting in glucose metabolism dysfunction. [0003] At present, the most important treatment method for type 1 diabetes is subcutaneous injection of insulin, but this method often makes the patient's blood sugar fluctuate greatly, easily causing hypoglycemia syncope; and injection of insulin can only temporarily control the condition, and cannot cure type 1 diabetes. [0004] Pancreatic islet transplantation can help patients produce their own insulin, but clinical practice shows that patients do not re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/7088A61P3/10
CPCA61K31/7088A61P3/10
Inventor林云锋高邵静雅蔡潇潇
OwnerSICHUAN UNIV