Supercharge Your Innovation With Domain-Expert AI Agents!

Parotiditis virus fluorencent amplification detection reagent box and detection method

A mumps virus and detection kit technology, applied in fluorescence/phosphorescence, biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of reaction product contamination, false positives, high requirements, etc., and achieve simple and convenient sampling , convenient and accurate judgment, high sensitivity effect

Inactive Publication Date: 2007-04-18
ZHEJIANG CENT FOR DISEASE CONTROL & PREVENTION
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the long time of virus isolation, high requirements, and low isolation rate; the sensitivity of serological methods is low, and they are not suitable for early diagnosis, etc., so that the use of these two methods is greatly limited.
Ordinary PCR technology is widely used in the specific detection of viral genes. It has the advantages of sensitivity, specificity, and rapidity, but there are disadvantages such as the need for electrophoresis to determine the reaction results, and the reaction products are prone to contamination, resulting in false positives.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Parotiditis virus fluorencent amplification detection reagent box and detection method
  • Parotiditis virus fluorencent amplification detection reagent box and detection method
  • Parotiditis virus fluorencent amplification detection reagent box and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] The steps of the TaqMan-MGB detection method are as follows:

[0066] (1) RNA extraction

[0067] Take 200 ul of the gargle solution and extract viral RNA (1 μg / μL) with the Reansy Mini Kit from QIAGEN, Germany.

[0068] (2) Fluorescent PCR amplification

[0069] Take the quantitative fluorescence amplification detection reagent to prepare the reaction solution, the reaction system is 25 μL each, including:

[0070] 5×RT-PCR buffer 5μL

[0071] Dimercaptothreitol 5mM

[0072] RNase inhibitor RNasin 0.8 unit / μL

[0073] Specific amplification upstream primer 0.88μM

[0074] Specific amplification downstream primer 0.88μM

[0075] Specific probe 0.28μM

[0076] The deoxynucleoside triphosphate mixture is:

[0077] dATP, dTTP, dCTP, dGTP each 200μM

[0078] Ampli TaqR DNA Polymerase 2.5 enzyme activity units / reaction

[0079] AMV reverse transcriptase 50 enzyme activity units / reaction

[0080] Analysis sample viral RNA (1μg / μL) 5μL

[0081] Make up to 25μL with...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention offers detecting reagent boxes for fluorescent augment of mumps virus, which include hemagglutinin gene standards of mumps virus, detecting reagent of fluorescent augment, DNA polymerase and reverse transcriptase. The detecting reagent of fluorescent augment mainly contains buffer solution of one-step RT-PCR, specificity exciters and probes, mixture of deoxidizing triphosphoric acid and nucleoside. The partial sequence of hemagglutinin gene standards of mumps virus is 5'- CTCAAGGACTGTTTGCCTCTTACACCACAACCACCTGCTTTCAAGATACCGGTGATGCTAGTG-3'. The specificity exciters have two sequences: the sequence of upstream exciters is 5'-CTCAAGGACTRTYTGCYTCSTA-3'and the sequence of downstream exciters is 5'-CTCTRGCAT CACCGGTATCTTGAA-3'. The equence of specificity probes is 5'-FAM-ACCACAACCACCTGC-NFQ-MGB-3', in which FAM is reporting fluorescent metakliny, NFQ is non-fluorescent annihilation metakliny, MGB is modifying metakliny. The detecting reagent boxes can detect pathogen nucleic acid directly. At the early stage of mumps disease, specificity gene of mumps virus can be detected, which facilitates early isolation, diagnosis and therapy.

Description

(1) Technical field [0001] The invention relates to a mumps virus fluorescence amplification detection kit and a detection method. (2) Background technology [0002] Mumps is an acute viral infection caused by mumps virus. The disease is highly contagious and can be prevalent in all seasons. Virus isolation and serological tests are the main means of laboratory diagnosis of mumps virus. However, due to the long time of virus isolation, high requirements, and low isolation rate; the sensitivity of serological methods is low, and they are not suitable for early diagnosis, etc., so that the use of these two methods is greatly limited. Ordinary PCR technology is widely used in the specific detection of viral genes. It has the advantages of sensitivity, specificity, and rapidity, but it has disadvantages such as electrophoresis is required to determine the reaction result, and the reaction product is prone to contamination, resulting in false positives. [0003] Fluorescent quan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/70G01N21/64
Inventor 卢亦愚严菊英冯燕茅海燕徐昌平史雯
Owner ZHEJIANG CENT FOR DISEASE CONTROL & PREVENTION
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More