Parotiditis virus fluorencent amplification detection reagent box and detection method

Abstract

The invention offers detecting reagent boxes for fluorescent augment of mumps virus, which include hemagglutinin gene standards of mumps virus, detecting reagent of fluorescent augment, DNA polymerase and reverse transcriptase. The detecting reagent of fluorescent augment mainly contains buffer solution of one-step RT-PCR, specificity exciters and probes, mixture of deoxidizing triphosphoric acid and nucleoside. The partial sequence of hemagglutinin gene standards of mumps virus is 5'- CTCAAGGACTGTTTGCCTCTTACACCACAACCACCTGCTTTCAAGATACCGGTGATGCTAGTG-3'. The specificity exciters have two sequences: the sequence of upstream exciters is 5'-CTCAAGGACTRTYTGCYTCSTA-3'and the sequence of downstream exciters is 5'-CTCTRGCAT CACCGGTATCTTGAA-3'. The equence of specificity probes is 5'-FAM-ACCACAACCACCTGC-NFQ-MGB-3', in which FAM is reporting fluorescent metakliny, NFQ is non-fluorescent annihilation metakliny, MGB is modifying metakliny. The detecting reagent boxes can detect pathogen nucleic acid directly. At the early stage of mumps disease, specificity gene of mumps virus can be detected, which facilitates early isolation, diagnosis and therapy.

Description

(1) Technical field [0001] The invention relates to a mumps virus fluorescence amplification detection kit and a detection method. (2) Background technology [0002] Mumps is an acute viral infection caused by mumps virus. The disease is highly contagious and can be prevalent in all seasons. Virus isolation and serological tests are the main means of laboratory diagnosis of mumps virus. However, due to the long time of virus isolation, high requirements, and low isolation rate; the sensitivity of serological methods is low, and they are not suitable for early diagnosis, etc., so that the use of these two methods is greatly limited. Ordinary PCR technology is widely used in the specific detection of viral genes. It has the advantages of sensitivity, specificity, and rapidity, but it has disadvantages such as electrophoresis is required to determine the reaction result, and the reaction product is prone to contamination, resulting in false positives. [0003] Fluorescent quan...

AI Technical Summary

Problems solved by technology

However, due to the long time of virus isolation, high requirements, and low isolation rate; the sensitivity of serological methods is low, and they are not suitable for early diagnosis, etc., so that the use of these two methods is greatly limited.

Ordinary PCR technology is widely used in the specific detection of viral genes. It has the advantages of sensitivity, specificity, and rapidity, but there are disadvantages such as the need for electrophoresis to determine the reaction results, and the reaction products are prone to contamination, resulting in false positives.

Images