72 results about "Mumps virus" patented technology

The present disclosure relates to novel compounds of formulas (1) through (19) and to a method for treating humans infected with a virus including various respiratory viruses such as members of the Paramyxoviridae family (respiratory syncytial virus (RSV), human metapneumovirus (HMPV), human parainfluenza virus (HPIV), measles virus, and mumps virus) with a compound of formulas (1) through (19). The present disclosure also relates to a cytopathic effect (CPE)-based assay that will assess virus-induced CPE for screening of compounds for treating viral diseases or inhibiting a virus.

The present invention provides methods and compositions to induce neutralizing antibodies in mammals to serotypes of dengue virus, measles virus, mumps virus, rubella and/or VZV virus.

The invention relates to the field of traditional Chinese medicines, especially to a preparation method of an antiviral oral liquid. The antiviral oral liquid is prepared from Chinese herbal medicines, has effects of releasing heat, eliminating dampness, cooling the blood and detoxifying, and is used to treat wind-heat cold, fever caused by warm disease, upper respiratory tract infection, influenza and mumps virus infection diseases. The preparation method of the antiviral oral liquid is simple to operate and is suitable for large-scale production. The ratio of Chinese herbal medicines is scientific. And by the adoption of the preparation method, waste of the Chinese herbal medicines is avoided.

The invention relates to a gene chip for detecting important respiratory pathogenic viruses. A preparation method of the gene chip comprises the following steps of: preparing a specific primer; preparing a virus specific probe; preparing an oligonucleotide chip; establishing an RT-PCR (Reverse Transcription-Polymerase Chain Reaction) system; establishing a hybrid system; preparing a visual detection reagent; and establishing a developing method. The gene chip prepared by the invention can be used for simultaneously discriminating nine general respiratory pathogenic viruses comprising A and B type influenza viruses, parainfluenza viruses type 1 and 2, human metapneumovirus, respiratory syncytial virus, measles virus, rubella virus and mumps virus, provides a new solution for quickly detecting the general respiratory pathogenic viruses at high throughout and can provide guidance for monitoring, clinically diagnosing and treating the respiratory pathogenic viruses.

The invention relates to a kind of natural medicine of broad spectrum antibiotic. At present, the broad spectrum antibiotic medicine with high effect and safety is at shortage all round the world. The invention is intended to extract laminarinsulphate or sulphonic acid sugar ester or sulphosalts from plant chickweed or other chickweed plant with two resin adsorption methods or a water extraction and alcohol precipition method. The spectrum antibiotic in the invention is distributed under 50,000 in the formula weight formed by carbon glycosidic bond and/or oxide glycosidic bond with phenol, especially the total flavones comprising apigenin. However, the invention mainly acts as total phenolic glycoside with the formula weight under 4,000. Besides, the invention can form brownish compound with the total flavones comprising apigenin and the glycosidic ingredients without sulfur element, so as to be applied as broad spectrum antibiotic drug. Therefore, the compound in the invention can be applied to cure ADIS virus, hepatitis virus, influenza virus and parainfluenza virus comprising SARS, adenovirus, verruca acuminate virus, enterovirus, mumps virus, herpes simplex virus, herpes zoster virus and varicella. No toxic effect has been found in the application. What is more, the invention can be made into 10 sorts of formulation, disinfector and health-improving products.

The invention discloses a protein chip for detecting pathogen antibodies of blood and cerebrospinal fluid and its preparing method, and the protein chip includes substrate and peculiar-culture or shape protein or polypeptide antigen of array distributed pathogen and contrasted dot coating, where the substrate is a glass substrate; and the antigen and contrasted dot coating refers to 13 antigens with ten indexes including HSV-I, HSV-II, VZV, CMV, EBV, RV, JEV, MV, MT and LP, uniformly distributed on the glass substrate in a dot matrix form, and positive contrast, negative contrast and blank contrast. The protein chip of the invention can obtain multiple-index reacting result only by one reaction, judges infection of different pathogens and has the characters of quickness, high efficiency, accuracy and parallel diagnosis.

The present invention relates to an application of pithecellobium clypearia extract in medicine and food. It adopts pithecellobium clypearia aqueous extract or ethyl alcohol extract as effective component and adds conventional medicinal auxiliary or food additive, and can make them into tablet, capsul, granule preparation, pills preparation and oral liquor preparation. Said pithecellobium clypearia extract has strong inhibition effect for influenza virus, parainfluenza virus, enteric virus, rhinovirus and mumps virus and has strong antioxidation activity.

The present invention is directed to a method for generating an antigen-specific immune response in a subject in general and in particular to administering a priming dose of an immunogenic composition of a recombinant mumps virus (rMuV) that encodes an antigen followed by administering a boosting dose of recombinant vesicular stomatitis virus (rVSV) encoding an antigen.

The invention discloses an mRNA methyltransferase-deficient mumps virus and a preparation method and application thereof, and belongs to the technical field of reverse genetics. The mRNA methyltransferase-deficient mumps virus is prepared through site-directed mutation of a mumps virus vaccine S79 strain, wherein the amino acid at the site 1792 of the L protein is mutated from K to A, or the aminoacid at the site 1814 of the L protein is mutated from A to G, or the amino acid at the site 1816 is mutated from G to A, or the amino acid at the site 1818 is mutated from G to A, or the amino acidat the site 1892 is mutated from D to A, or the amino acid at the site 1917 is mutated from D to A, or the amino acid at the site 1953 is mutated from K to A, or the amino acid at the site 1990 is mutated from E to A. According to the invention, through site-directed mutation, the rescued recombinant mumps virus is weakened in virulence and good in immunogenicity, so that the immunogenicity of themumps virus attenuated vaccine is retained, and the safety of the mumps virus attenuated vaccine is improved.

The invention relates to a wide-spectrum antiviral natural drug, while present world is lack in high-effect safe wide-spectrum antiviral natural drug. The invention, via two the adsorptions of two different resins, extracts a compound from plant FanLu, while the compound contains oligosaccharide or/and polyose and flavonoid as brown flavonoid glycoside with sulfonic acid group formed with apione, whose molecule weight is lower than 4, 000. The inventive compound can be used to treat AIDS, hepatitis viruse, influenza virus, or the like, without toxicity, while it can be made into 10 kinds of agent and health-care products.

This invention relates to a method for recombinantly producing, via rescue of mumps virus, a nonsegmented, negative-sense, single-stranded RNA virus, and immunogenic compositions formed therefrom. Additional embodiments relate to methods of producing the mumps virus as an attenuated and/or infectious virus. The recombinant viruses are prepared from cDNA clones, and, accordingly, viruses having defined changes, including nucleotide/polynucleotide deletions, insertions, substitutions and re-arrangements, in the place of the genome are obtained.

The invention discloses a system used for rescuing a mumps virus and a rescue method, and belongs to the field of application of reverse genetics. The system comprises a recombinant transcription vector containing a whole genome cDNA (complementary deoxyribonucleic acid) of the mumps virus, a helper plasmid I containing an NP gene of the mumps virus, a helper plasmid II containing a P gene of themumps virus and a helper plasmid III containing an L gene of the mumps virus. The mumps virus can be effectively rescued from outside of a body by adopting a 3+1 plasmid rescue system (helper plasmidsand the transcription vector that are used for expressing an N protein, a P protein and an L protein of a MuV-S79 strain), the recombinant mumps virus can be abundantly amplified by a cell culture method, and the recombinant mumps virus can be directly used for manufacturing vaccines without any processing, so that the problems of the traditional vaccine that the production is time-saving and labor-saving, and the process is complex are solved. Additionally, a solution is provided for developing a novel vaccine by engineering the mumps virus by adopting a molecular clone technology in the future.

The present invention provides a novel vaccine against mumps composed of highly immunogenic rMuVJL2 (recombinant mumps virus Jeryl Lynn2 based). Further, method to develop said immunogenic compositionis described in the present invention. The vaccine according to the present invention is safe, cost effective, highly efficacious and stable and consistent in terms of productivity.

The pharmaceutical composition is useful for treating epithelial tumors in a subject and contains at least two antigens and a pharmaceutically acceptable carrier, where each of the antigens induces or is capable of inducing a cutaneous delayed type hypersensitivity (DTH) response in the subject. This composition is particularly useful in treating epithelial tumors, such as warts or verrucae, that are induced by or related to papillomavirus. Antigens useful in the present pharmaceutical composition are anergy panel antigens, such as killed mumps virus, candida extract, trichophyton extract or comparable antigenic extracts. An additional pharmaceutical composition, also useful for treating epithelial tumors, contains at least one antigen that induces or is capable of inducing a cutaneous DTH response in a subject, at least one cytokine or colony stimulating factor and a pharmaceutically acceptable carrier. Kits containing these pharmaceutical compositions are useful for this immunotherapy.

The invention relates to a mumps virus ingredient vaccine for human, and its preparation method and uses, wherein the preparing process comprises isolating a parotiditis virus from human body infected by parotiditis virus through conventional methods, adapting the virus to Vero cell culture to prepare single-layer static or rotary Vero cell culture, carrying out virus deactivation, decomposition and purification, predicating the two antigenic components of HN and NP by means of molecular weights, using the antigen composition as the semi-finished vaccine after protein content measurement according to the semi-finished vaccine protein concentration, diluting to 100mul/ml with physiological saline, formulating Al(OH)3 with a concentration of 10.87mg/ml simultaneously, finally mixing the two formulations.

Disclosed is a dark brown combination with the molecular of 1,000-100,000, which is composed of total glycopeptides ingredient and total flavonoid ingredient, and extracted from stellaria through three methods and used as safer and more efficient natural broad-spectrum anti-viral medicine. The total peptide part accounts for 15%-25% and is composed of 17 types of amino acids respectively according to the proportions, such as by proportion, such as aspartic acid, methionine and isoleucine; the total sugar accounts for 15%-30% and is composed of glucose, galactose and arabinose; the total flavonoid which is mainly apigenin glycoside accounts for 10%-40%; Oxygenated alkane which contains alcohols accounts for 25%-40%. The combination can be used as the medicines for the treatment of the diseases, including HIV, hepatitis viruses, influenza virus such as Highly-pathogenic avian influenza virus, condyloma virus, herpes virus and mumps virus, and have no toxicity after application; the combination can be made into more than 10 types of medicinal preparations and health care products, and avoid environmental pollution during the production process.

The invention provides an evaluation model for rat neurotoxicity of parotitis virus, concretely a device for evaluating the neurotoxicity of the parotitis virus. The model comprises(I) a virus inoculation module for performing virus inoculation of the parotitis virus to be evaluated to the lateral ventricle of a rat; (II) a processing module for carrying out vibration slicing on the fixed rat brain; (III) an imaging module for scanning and imaging an obtained mouse brain slice; and (IV) an analysis module used for calculating a neurotoxicity index through a formula I: the neurotoxicity index =S1/S0 *100 (formula I) according to the cross sectional area S1 of a cavity formed by hydrocephalus in the longitudinal section of the rat brain and the total cross sectional area S0 of the rat brainin the obtained image. The results show that the result is stable, the stability is high, wild strains can be distinguished from vaccine strains, and compared with an existing monkey body neurotoxicity model, the animal cost and the operation difficulty are greatly reduced.

The invention offers detecting reagent boxes for fluorescent augment of mumps virus, which include hemagglutinin gene standards of mumps virus, detecting reagent of fluorescent augment, DNA polymerase and reverse transcriptase. The detecting reagent of fluorescent augment mainly contains buffer solution of one-step RT-PCR, specificity exciters and probes, mixture of deoxidizing triphosphoric acid and nucleoside. The partial sequence of hemagglutinin gene standards of mumps virus is 5'- CTCAAGGACTGTTTGCCTCTTACACCACAACCACCTGCTTTCAAGATACCGGTGATGCTAGTG-3'. The specificity exciters have two sequences: the sequence of upstream exciters is 5'-CTCAAGGACTRTYTGCYTCSTA-3'and the sequence of downstream exciters is 5'-CTCTRGCAT CACCGGTATCTTGAA-3'. The equence of specificity probes is 5'-FAM-ACCACAACCACCTGC-NFQ-MGB-3', in which FAM is reporting fluorescent metakliny, NFQ is non-fluorescent annihilation metakliny, MGB is modifying metakliny. The detecting reagent boxes can detect pathogen nucleic acid directly. At the early stage of mumps disease, specificity gene of mumps virus can be detected, which facilitates early isolation, diagnosis and therapy.

The present invention provides the complete genomic sequence of the epidemic mumps virus (MuV) strain MuV^Iowa/us/06. Further, a reverse genetics system was constructed and used to rescue recombinant viral constructs that are attenuated compared to MuV^Iowa/us/06 and JL vaccine viruses. Such constructs include viral constructs lacking the open reading frame (ORF) of the SH gene (rMuVΔSH) and/or incapable of expressing the V protein (rMuVΔV).

The invention discloses a Chinese herbal medicinal disinfection incense, and relates to the technical field of live pig farming. The Chinese herbal medicinal disinfection incense is produced from 50-60 parts of wood powder, 15-18 parts of an alcohol extract liquid of Atractylodes lancea, 16-20 parts of an alcohol extract liquid of Artemisia argyi, 10-15 parts of an alcohol extract liquid of dahurian angelica root, 12-14 parts of an alcohol extract liquid of Acorus calamus Linn, 8-15 parts of an alcohol extract liquid of Juncus effusus, 10-16 parts of a Gleditsia sinensis extract liquid, 10-14 parts of a sweet wormwood seed extract liquid, 11-15 parts of a dried orange peel extract liquid, 3-8 parts of a combustion improver and 9-20 parts of an adhesive. The Chinese herbal medicinal disinfection incense is used for disinfecting air in hog houses, has an obvious antibacterial effect on bacteria and fungi, has an inhibition effect on adenoviruses, rhinoviruses, herpes viruses, influenza viruses and mumps viruses, is reasonable and safe, is convenient for enhancing the immunity of pigs, and also has the advantages of disease prevention and resistance, no toxic or side effects, no pollution to environment, fast action and low price.

The invention relates to a medical immunodetection method and particularly relates to a method for using quantum-dot labeled immunochromatography test paper to detect mumps virus by an immunological method. The quantum-dot labeled immunochromatography test paper is characterized in that a plastic board is stuck with a glass cellulose membrane A, a glass cellulose membrane B of a quantum-dot labeled mumps virus IgG monoclonal antibody, a nitrocellulose membrane and water absorbing paper from bottom to top in sequence, wherein one end of the nitrocellulose membrane is provided with mumps virus polyclonal antibody and rabbit antimouse second antibody so as to form a detecting band T and a quality control band C; the quantum-dot labeled mumps virus IgG monoclonal antibody is positioned at one end of the glass cellulose membrane and corresponds to the detecting band T and the quality control band C, and the quantum-dot labeled mumps virus IgG monoclonal antibody is positioned at one end of a sampling point. The method has the advantage that the detection sensitivity is about 1000 times higher than that of the commonly-used method.

The invention discloses a primer, a probe and a kit all used for detecting mumps virus, and belongs to the technical field of kits. The primer and the probe comprise a forward primer for detecting mumps virus, a reverse primer for detecting mumps virus and a probe for detecting mumps virus. The kit comprises the primer and the probe. The primer, the probe, the kit and a detection method possess the characteristic of high sensitivity, the detection speed is fast, and the whole detection process only needs 2-3 h.

The invention relates to a recombinant virus and application thereof in mumps virus neutralizing antibody detection, and belongs to the technical field of biology. The invention provides a recombinant virus and a method for detecting a neutralizing antibody of a mumps virus by using the recombinant virus as a neutralizing virus. The recombinant virus takes the mumps virus as a live vector to express a marker gene; the traditional mumps virus neutralizing antibody detection method needs 7 days for final judgment of the result, while the neutralizing antibody detection method disclosed by the invention only needs 3 days, and the result conformity is extremely high; moreover, according to the neutralizing antibody detection method, the neutralizing titer of the antibody in the to-be-detected sample is calculated through fluorescence, the neutralizing antibody detection method can be used in a high-flux fluorescence detection instrument, data can be automatically and electronically stored, and meanwhile, the limitation of human factors in result judgment is shielded.