Full length cDNA homogenizing subtractive hybridization method

A hybridization method and uniform technology, applied in the direction of DNA preparation, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems that the efficiency of subtractive hybridization cannot be further improved, the cost is high, and the false positive rate is high

Inactive Publication Date: 2008-11-26
ZHEJIANG UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The above-mentioned methods have a common shortcoming: that is, what is obtained is a partial fragment of cDNA; to obtain a full-length cDNA sequence, it is necessary to use rapid amplification of cDNA ends (rapid amplification of cDNA ends, RACE) or to screen from a cDNA library, but in genes with When there are alternative promoters, splicing and polyadenylation signal sequences, and when the gene belongs to a multigene family, it will be very difficult to obtain a correct full-length cDNA sequence with RACE, and the construction of the cDNA library and the screening itself are difficult. is time consuming
[0004] In addition, the above methods also have some other disadvantages: DD can only obtain partial cDNA sequences of a few genes at a time, which cannot be applied to high-throughput screening, and has a high false positive rate; RDA cannot effectively isolate non-target molecules. If it is subtracted, the false positive rate is also higher, and it is more conducive to the enrichment of genes with high expression levels, and it is easy to lose the information of genes with low expression levels; SAGE requires a large number of sequencing and analysis of a large amount of sequence information, and the cost is high; SSH Although it is highly efficient and can homogenize the content of cDNA with different expression levels, there are also certain false positives, and the strength of inhibitory PCR is controlled by many factors, which greatly affects the results. In addition, the double-stranded driver in SSH makes subtractive hybridization Efficiency cannot be further improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Full length cDNA homogenizing subtractive hybridization method
  • Full length cDNA homogenizing subtractive hybridization method
  • Full length cDNA homogenizing subtractive hybridization method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] In order to obtain the genes specifically expressed in the male reproductive system of Macrobrachium rosenbergii, the tissue where the androgenic gland is located and the adjacent part of the vas deferens was used as a tester, and the ovary sample was used as a driver. The method on the manual extracts total RNA for subtractive hybridization:

[0055] The primer or linker sequences involved are as follows:

[0056] 5'CP: 5'-TGGTTGCCATAAGCGGATCATC-3'

[0057] PH5'CP: 5'-pTGGTTGCCATAAGCGGATCATC-3'

[0058] 3'AP: 5'- TGGTTGGACTCGGTTTGGACG -3'

[0059] PH3'AP:5'-p TGGTTGGACTCGGTTTGGACG -3'

[0060] ADP I:

[0061] 5'-GTAATACGACTCACTATAGGGCTGTAGCGTGAAGACGACAGAATTCTTAAGGTAGCT-3'

[0062] 3'-AGAATTCCATCG-5'

[0063] ADP II:

[0064] 5'-GTAATACGACTCACTATAGGGCTGCAGGGAACCAATC CTC TCTTAAGGTAGC T-3'

[0065] 3'-AGAATTCCATCG-5'

[0066] 5'BK:

[0067] 5'-AATTAACCCTCACTAAAGGGTGGTTGCCATAAGCGGATCATC-3'

[0068] 3'BK:

[0069] 5’-AATTAACCCTCACTAAAGGG TGGTTGGACTCGGT...

Embodiment 2

[0093] Example 2: Comparison of FNSH and SSH

[0094] Macrobrachium rosenbergii (Macrobrachium rosenbergii) ovary cDNA was used as the driver of SSH and FNSH, and also as the non-differentially expressed gene in the tester of SSH and FNSH. The cDNA of N74 (GenBank sequence number EF364538, obtained from Example 1 and finally confirmed to be specifically expressed in the male reproductive system) was used as the differentially expressed cDNA in the tester. Add different amounts of N74 cDNA to the tester and perform SSH respectively (the SSH tester is amplified with PH5'CP and PH3'AP and then ligated with the adapter, the driver is amplified with 5'CP and 3'AP and digested with BstXI, the specific steps See: Diatchenko L., Lau Y.-F.C., Campbell A.P., Chenchik A., Moqadam F., Huang B., Lukyanov S., Lukyanov K., Gurskaya N., Sverdlov E.D., et al. 1996. Suppression subtractive hybridization : A method for generating differentially regulated or tissue-specific cDNA probes and libra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for homogenization subtractive hybridization of full length cDNA. The method comprises the following steps in sequence: (1) synthesizing a first chain cDNA; (2) synthesizing a double chain cDNA; (3) selective connection and primer extension; (4) subtractive hybridization; (5) PCR augmentation of cDNA of differential expression; wherein, the PCR products of the subtractive hybridization can be directly cloned to a vector so as to construct cDNA libraries, where differentially expressed genes are concentrated; the libraries can be utilized to analyze gene expression, prepare gene chips and be marked as probe which selects the differentially expressed genes from the existing libraries; in addition, if the subtractive efficiency is not high enough, the subtractive hybridization can repeat for the PCR products of subtractive hybridization to improve the homogenization and the subtractive efficiency. The method for homogenization subtractive hybridization of the full length cDNA (FNSH) creates the beneficial effects of high subtractive efficiency of differential genes, high efficiency of enriching differential expressed genes, high homogenization and gain of the full length cDNA.

Description

(1) Technical field [0001] The invention relates to a full-length normalization subtractive hybridization (full-length normalization subtractive hybridization, FNSH) method, which is applied to enrichment, screening, cloning and identification of differentially expressed genes. (2) Background technology [0002] The types and quantities of genes expressed by various tissues or cells of an organism, and the same tissue or cell at different developmental stages are not the same, and these genes with different expression levels or expression stages are called differentially expressed genes (differentially expressed genes) gene). Differentially expressed genes play an important role in the development, differentiation, and carcinogenesis of organisms, so cloning and identification of these differentially expressed genes can strongly promote our research and reveal the mechanism of these life processes. Currently, methods for screening differentially expressed genes mainly inclu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/10C12Q1/68
Inventor戴忠敏朱晓静杨卫军
OwnerZHEJIANG UNIV