Nocardia seriolae fluorescence quantitative PCR detection kit and detection method
A technology of Nocardia amberjack and detection kit, which is applied in fluorescence/phosphorescence, determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve problems such as difficulty in detection and prevention of fish diseases
Inactive Publication Date: 2011-02-02
NINGBO UNIV
View PDF1 Cites 14 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
We have found the pathogen in large yellow croakers cultured in seawater and snakeheads cultured in freshwater. Since the pathogen resides in the internal organs (liver, spleen, kidney, heart, etc.) of animals, the main symptom is white nodules appearing in internal organs, and early There are no obvious symptoms on the surface, which brings difficulties to the detection and control of fish diseases
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreExamples
Experimental program
Comparison scheme
Effect test
Embodiment 1
Embodiment 2
Embodiment 3
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Login to View More
Abstract
The invention discloses a nocardia seriolae fluorescence quantitative PCR detection kit and a nocardia seriolae fluorescence quantitative PCR detection method. The detection kit comprises 10.0 microliters of SYBRPremix ExTaqTM special agent, 10 micromol / L upstream primer solution and 0.8 microliters of downstream primer solution, and is characterized in that the nucleotide sequence of the upstream primer is 5,TGCTACAATGGCCGGTACAGAG3; and the nucleotide sequence of the downstream primer is 5,TTCACGAGGTCGAGTTGCAGAC3. The detection method comprises pathogenic bacteria extraction, pathogenic bacteria enzymolysis, DNA coarse extract preparation, DNA coarse extract purification and detection. The detection kit can detect nocardia seriolae in early stage sensitively, quickly, quantificationally and specifically. The sensitivity of the detection kit is up to 10 to 6 microgram / microliter, the quantification can be realized basically on the level of 10 to 5 microgram / microliter.
Description
technical field The invention relates to a detection reagent for the yellowtail Nocardia, in particular to a fluorescent quantitative PCR detection kit and a detection method for the yellowtail Nocardia. Background technique Nocardia seriolea (Nocardia seriolea) is a pathogenic bacterium discovered in recent years in fish, shellfish, crustaceans and other animals. The incidence rate is high, the hazard is great, the average morbidity rate is as high as 40%, and the average mortality rate is 35%. We have found the pathogen in large yellow croakers cultured in seawater and snakeheads cultured in freshwater. Since the pathogen resides in the internal organs (liver, spleen, kidney, heart, etc.) of animals, the main symptom is white nodules appearing in internal organs, and early There are no obvious symptoms on the surface, which brings difficulties to the detection and prevention of fish diseases. Therefore, it is particularly important and urgent to establish the detection t...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline

Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/06G01N21/64
Inventor 王国良刘璐李思源
Owner NINGBO UNIV
Features
- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
Why Patsnap Eureka
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com