Nocardia seriolae fluorescence quantitative PCR detection kit and detection method

Abstract

The invention discloses a nocardia seriolae fluorescence quantitative PCR detection kit and a nocardia seriolae fluorescence quantitative PCR detection method. The detection kit comprises 10.0 microliters of SYBRPremix ExTaqTM special agent, 10 micromol / L upstream primer solution and 0.8 microliters of downstream primer solution, and is characterized in that the nucleotide sequence of the upstream primer is 5,TGCTACAATGGCCGGTACAGAG3; and the nucleotide sequence of the downstream primer is 5,TTCACGAGGTCGAGTTGCAGAC3. The detection method comprises pathogenic bacteria extraction, pathogenic bacteria enzymolysis, DNA coarse extract preparation, DNA coarse extract purification and detection. The detection kit can detect nocardia seriolae in early stage sensitively, quickly, quantificationally and specifically. The sensitivity of the detection kit is up to 10 to 6 microgram / microliter, the quantification can be realized basically on the level of 10 to 5 microgram / microliter.

Description

technical field The invention relates to a detection reagent for the yellowtail Nocardia, in particular to a fluorescent quantitative PCR detection kit and a detection method for the yellowtail Nocardia. Background technique Nocardia seriolea (Nocardia seriolea) is a pathogenic bacterium discovered in recent years in fish, shellfish, crustaceans and other animals. The incidence rate is high, the hazard is great, the average morbidity rate is as high as 40%, and the average mortality rate is 35%. We have found the pathogen in large yellow croakers cultured in seawater and snakeheads cultured in freshwater. Since the pathogen resides in the internal organs (liver, spleen, kidney, heart, etc.) of animals, the main symptom is white nodules appearing in internal organs, and early There are no obvious symptoms on the surface, which brings difficulties to the detection and prevention of fish diseases. Therefore, it is particularly important and urgent to establish the detection t...

AI Technical Summary

Problems solved by technology

We have found the pathogen in large yellow croakers cultured in seawater and snakeheads cultured in freshwater. Since the pathogen resides in the internal organs (liver, spleen, kidney, heart, etc.) of animals, the main symptom is white nodules appearing in internal organs, and early There are no obvious symptoms on the surface, which brings difficulties to the detection and control of fish diseases