DPO primer pair for TGEV detection, kit containing same and application thereof
A DPO primer, virus detection technology, applied in the direction of microorganism-based methods, microorganisms, microorganisms determination/inspection, etc., can solve the problem of complex primer design process, unavoidable non-specific amplification and primer dimer, etc., to achieve design Simple, highly sensitive and specific effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Embodiment 1 is used for the design and synthesis of the DPO primer set that porcine transmissible gastroenteritis virus detects
[0046] The N gene is determined as the target gene of the present invention by analyzing the biological information of porcine transmissible gastroenteritis virus. According to the porcine transmissible gastroenteritis N gene sequence registered in Genbank, a highly conserved region was selected by using DNAMAN to compare the sequences, specifically the 32-212 coding N gene. According to the conserved region, a DPO primer set for porcine transmissible gastroenteritis virus detection was designed and synthesized, including upstream primers and downstream primers. The specific sequences are as follows:
[0047]TGEV-DPO-F: 5'CTGTTCTTGCCGCACTTAAAAIIIIIGGTGTTGAC3'
[0048] TGEV-DPO-R: 5'TAGCTCCATAAAATCTTGTCACATCIIIIITACCTGCAG3'.
[0049] Wherein, "I" represents inosine.
Embodiment 2
[0050] Example 2 Establishment of Porcine Transmissible Gastroenteritis Virus Detection Method
[0051] 1. Establishment of detection method for porcine transmissible gastroenteritis virus
[0052] (1) Extract the total RNA of the sample to be tested
[0053] Take about 100mg of TGEV positive and negative sample tissue or known positive TGEV virus cell culture in an ice-bath homogenizer, add 1ml Trizol (Invitrogen, USA), quickly grind into a homogenate, add 200μl chloroform, shake for 30S, and place on ice Leave it for 5min. 4°C, 12000rpm, centrifuge for 10min, take the upper aqueous phase and transfer it to another 1.5ml centrifuge tube, add an equal volume of isopropanol, invert and mix well, and stand at -20°C for 2h. Then 4°C, 12000rpm, centrifuge for 20min, discard the supernatant, add 1ml of 75% ethanol, mix gently, 4°C, 12000rpm, centrifuge for 10min, absorb the supernatant, dry at room temperature, add 20μl DEPC-treated deionized water Dissolve the precipitate and s...
Embodiment 3
[0075] Embodiment 3 comparative test
[0076] 1. Design and comparison of DPO primers and conventional primers for porcine transmissible gastroenteritis Real-time PCR
[0077] The above-mentioned recombinant plasmid pMD19-T-N gene was subjected to point mutation, and ① three sites were mutated at the 3' end (named TGEV-N3, shown in SEQ ID NO.2); ② three sites were mutated at the 5' end (named TGEV-N3). -N5, shown in SEQ ID NO.3); ③ five sites 3' mutated (named TGEV-SN3, shown in SEQ ID NO.4); ④ 5' mutated five sites (named TGEV-SN5 , shown in SEQ ID NO.5); ⑤ unmutated N gene (named TGEV-N, shown in SEQ ID NO.1). The specificities of the conventional primer TGEV-CG and the DPO primer designed in the present invention were compared respectively, and the primer sequences are shown in Table 4.
[0078] Table 4 Primer Sequence
[0079]
[0080] Note: "I" means inosine.
[0081] Using the above-mentioned mutated gene as a template, RT-PCR comparative experiments were carried ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap