DPO primer pair for TGEV detection, kit containing same and application thereof

A DPO primer, virus detection technology, applied in the direction of microorganism-based methods, microorganisms, microorganisms determination/inspection, etc., can solve the problem of complex primer design process, unavoidable non-specific amplification and primer dimer, etc., to achieve design Simple, highly sensitive and specific effects

Active Publication Date: 2018-04-20
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Currently commonly used methods for clinical diagnosis include pathological examination, serological detection and RT-PCR detection, etc., such as Wang Shao et al. 2007, 28(11): 12-16) discloses a method for RT-PCR detection of porcine transmissible gastroenteritis virus, but the design process of RT-PCR detection primers is complicated, and repeated optimization of primer parameters is required, sometimes even after repeated optimization. Non-specific amplification and the presence of primer-dimers are still unavoidable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DPO primer pair for TGEV detection, kit containing same and application thereof
  • DPO primer pair for TGEV detection, kit containing same and application thereof
  • DPO primer pair for TGEV detection, kit containing same and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1 is used for the design and synthesis of the DPO primer set that porcine transmissible gastroenteritis virus detects

[0046] The N gene is determined as the target gene of the present invention by analyzing the biological information of porcine transmissible gastroenteritis virus. According to the porcine transmissible gastroenteritis N gene sequence registered in Genbank, a highly conserved region was selected by using DNAMAN to compare the sequences, specifically the 32-212 coding N gene. According to the conserved region, a DPO primer set for porcine transmissible gastroenteritis virus detection was designed and synthesized, including upstream primers and downstream primers. The specific sequences are as follows:

[0047]TGEV-DPO-F: 5'CTGTTCTTGCCGCACTTAAAAIIIIIGGTGTTGAC3'

[0048] TGEV-DPO-R: 5'TAGCTCCATAAAATCTTGTCACATCIIIIITACCTGCAG3'.

[0049] Wherein, "I" represents inosine.

Embodiment 2

[0050] Example 2 Establishment of Porcine Transmissible Gastroenteritis Virus Detection Method

[0051] 1. Establishment of detection method for porcine transmissible gastroenteritis virus

[0052] (1) Extract the total RNA of the sample to be tested

[0053] Take about 100mg of TGEV positive and negative sample tissue or known positive TGEV virus cell culture in an ice-bath homogenizer, add 1ml Trizol (Invitrogen, USA), quickly grind into a homogenate, add 200μl chloroform, shake for 30S, and place on ice Leave it for 5min. 4°C, 12000rpm, centrifuge for 10min, take the upper aqueous phase and transfer it to another 1.5ml centrifuge tube, add an equal volume of isopropanol, invert and mix well, and stand at -20°C for 2h. Then 4°C, 12000rpm, centrifuge for 20min, discard the supernatant, add 1ml of 75% ethanol, mix gently, 4°C, 12000rpm, centrifuge for 10min, absorb the supernatant, dry at room temperature, add 20μl DEPC-treated deionized water Dissolve the precipitate and s...

Embodiment 3

[0075] Embodiment 3 comparative test

[0076] 1. Design and comparison of DPO primers and conventional primers for porcine transmissible gastroenteritis Real-time PCR

[0077] The above-mentioned recombinant plasmid pMD19-T-N gene was subjected to point mutation, and ① three sites were mutated at the 3' end (named TGEV-N3, shown in SEQ ID NO.2); ② three sites were mutated at the 5' end (named TGEV-N3). -N5, shown in SEQ ID NO.3); ③ five sites 3' mutated (named TGEV-SN3, shown in SEQ ID NO.4); ④ 5' mutated five sites (named TGEV-SN5 , shown in SEQ ID NO.5); ⑤ unmutated N gene (named TGEV-N, shown in SEQ ID NO.1). The specificities of the conventional primer TGEV-CG and the DPO primer designed in the present invention were compared respectively, and the primer sequences are shown in Table 4.

[0078] Table 4 Primer Sequence

[0079]

[0080] Note: "I" means inosine.

[0081] Using the above-mentioned mutated gene as a template, RT-PCR comparative experiments were carried ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a DPO primer pair for TGEV detection, a kit containing the primer pair and application of the DPO primer pair. The DPO primer pair for the TGEV detection comprises an upstreamprimer and a downstream primer. Furthermore, according to the invention, the DPO primer pair is adopted and combined with a real-time fluorescence quantification PCR method, so that a specific and rapid DPO-real time RT-PCR detection method for TGEV is established, and the method is simple, strong in specificity and high in sensitivity, and can realize quantitative, rapid, specific, and sensitiveresult judgment which cannot be accomplished by the existing detection technologies, therefore, the DPO primer pair for the TGEV detection and the kit containing the DPO primer pair provide a new technical means for the rapid and accurate detection of TGEV.

Description

technical field [0001] The invention relates to a primer set for detecting porcine transmissible gastroenteritis virus, a kit containing the primer set and its application, in particular to a dual-purpose kit for qualitative and quantitative detection of porcine transmissible gastroenteritis virus. A priming oligonucleotide (DPO) primer set, a kit containing the primer set and applications thereof. The invention belongs to the technical field of biological detection. Background technique [0002] Porcine transmissible gastroenteritis (Transmissible gastroenteritis) is a highly contagious, acute gastrointestinal infectious disease caused by porcine transmissible gastroenteritis virus (TGEV). It is characterized by vomiting, severe diarrhea and dehydration, and is seriously harmful. It is one of the main viral infectious diseases affecting the development of pig industry, and the disease is often mixed with porcine epidemic diarrhea and porcine rotavirus. Sick pigs and virus...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12R1/93
CPCC12Q1/6851C12Q1/701C12Q2531/113C12Q2563/107
Inventor 徐义刚王紫微王丽周晗唐丽杰李一经
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap