Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

452results about How to "Quality is safe and reliable" patented technology

Method for producing docosahexenoic acid by fermenting schizochytrium

The invention relates to a method for producing triglyceride type docosahexenoic acid fat by industrially fermenting schizochytrium. The method comprises the following step: the docosahexenoic acid fat is prepared by fermenting the schizochytrium taken as the strain with the a culture medium with microelements; wherein the culture medium with the microelements comprises a carbon source, a nitrogen source, inorganic salt and microelements, and the microelements comprise at least one of biotin, chlorophyll, beta-carotene, vitaminB1, vitaminB6 and vitaminB12. The prepared docosahexenoic acid fat does not need to be further chemically modified and can be directly used by people needing DHA, including infants, pregnant women, breast feeding women or patients who suffer from diseases due to insufficient DHA and need to supplement DHA. The invention has the advantages of high DHA content, high purity, safe and reliable quality, low production cost, stable production and almost no EPA; and the environmental-friendly, safe and high-content triglyceride type DHA fat can be produced with low cost at a large scale.
Owner:湖北福星生物科技有限公司

Premix compound for aquatic products, application thereof in feed additive, and batch thereof

The invention discloses premix compound for aquatic products, the application thereof in feed additive and the batch thereof. In the premix compound per kilogram, vitamin B complex accounts for 80 to 140g, composite trace element accounts for 110 to 200g, taurine accounts for 100 to 300g, phytase accounts for 10 to 30g, glutamine accounts for 100 to 300g, DMPT accounts for 5 TO 20 g, composite microbial ecological agent accounts for 1 to 10g, composite traditional Chinese medicine composition accounts for 1 to 10g, and the margin is a carrier. The ingredients of the composite microbial ecological agent include fermented powder of bacillus subtilis CGMCC, No. 4628, fermented powder of bacillus licheniformis CGMCC, No. 5094 and fermented powder of enterococcus faecalis CGMCC, No. 5092. The main ingredients of the composite microbial ecological agent include three probiotics. Not only the probiotic function is achieved, but also the premix compound can be used for purification and conditioning to aquaculture water body, the environmental suitability is strong, the function is stable, and pollutants such as ammonia nitrogen, tric nitrogen, trite nitrogen, COD and the like in the water body are effectively degraded.
Owner:TIANJIN CHANGNONG TECH +1

Extract of mulberry twig and its extracting process and novel usage

An extract of mulberry twigs is dislcosed, which can be used to prepare the food or the medicine to cure hyperuricemia and gout diseases. The said extract is prepared from mulberry twigs through extracting in solvent (aqueous solution of alcohol, chloroform, acetone, etc) at 10-100 deg.C more than one time, mergint the liquid extracts, recovering solvent, regulating pH value to 7.5-9.5, centrifugal separation to obtain supernatant, regulating pH value to 4-6, deposition, water washing wand drying. Several other approaches for purifying it are also disclosed.
Owner:NANJING UNIV +1

Production process for wheat germ powder

The invention discloses a production process for wheat germ powder and belongs to the technical field of deep grain processing. Cordyceps militaris powder, walnut powder, pearl barley powder and bee pollen are adopted as auxiliary materials in the production process, wherein the mixture ratio of the cordyceps militaris powder to the walnut powder to the pearl barley powder to the bee pollen to the wheat germ powder in part by mass is 0.3-0.7 : 1.5-3 : 1.5-3 : 0.4-0.8 : 97-103. The production process comprises the steps as follows: filtering by a vibration sieve; deactivating enzyme and drying; conveying by a conveying belt; carrying out superfine grinding; sieving by an air jet sieve; carrying out three-dimensional mixing; carrying out microwave sterilization; and checking and packing. According to the production process, wheat germs are dried, subjected to enzyme deactivation, ground into ultrafine powder with fineness of 80-500 and subjected to microwave sterilization, so that the mouth feel of the wheat germ powder is improved, and the wheat germ powder with various wheat tastes and safe and reliable quality is produced.
Owner:山东生命海生物科技有限公司

Closed loop type fish and vegetable symbiosis system

PendingCN109258545AImprove stability and resource utilization efficiencyIncrease the hydroponic areaPisciculture and aquariaAgriculture gas emission reductionCarbon dioxideSystem stability
The invention discloses a closed loop type fish and vegetable symbiosis system. The closed loop type fish and vegetable symbiosis system comprises a buffer pool, a fishpond, a sedimentation tank, a disinfection tank, a filter tank, a biofiltration tank, a hydroponic area, a fermenting tank and a dry-wet separation device. Fish manure and other waste generated by fish are subjected to sedimentation, disinfection, filtration, fermentation and other circular processing to be converted into nutrition required for vegetables. Oxygen generated by photosynthesis of the vegetables can be utilized by the fish, carbon dioxide generated by fish breathing provides a raw material for the photosynthesis of the vegetables, thereby efficiently utilizing water, gas, nutrition and other resources. Through reasonable layout and closed-loop design of each module of the system, the stability and running efficiency of the system are effectively improved, the hydroponic area corresponding to a water body ofeach unit is increased, the construction cost is reduced, the large-scale and commercialized promotion can be achieved; the closed loop type fish and vegetable symbiosis system avoids the problem of environment pollution possibly generated by aquaculture, can also harvest the fish and vegetables with considerable quantity and safe quality, thereby satisfying the demands of people for food safety,environmental protection and other aspects.
Owner:付为森

Hospital information system

This invention discloses a hospital information system including HIS, PACS and LIS, in which, all the systems are connected by exchanges to realize information transmission and exchange.
Owner:ZHONG SHAN PEOPLES HOSPITAL

Planting method for organic rice in mountainous area

InactiveCN105104044AWith sustainable production capacityFull of nutritionSuperphosphatesAnimal huntingInsect pestOrganism
The invention discloses a planting method for organic rice in a mountainous area. The planting method includes the following steps of address selecting, field preparing, seed processing, sowing and seedling raising, seedling transplanting, insect pest treating, later-stage fertilizer managing, irrigation processing, harvesting and straw and rice husk processing. According to the planting method for the organic rice in the mountainous area, fertilizer and pesticides are not used in the planting process for preventing insect and diseases, a solar insect killing lamp is mainly adopted, and ducks, frogs and fishes are stocked in a paddy field. The solar insect killing lamp integrates energy conservation, environmental friendliness, safety, illumination and the function of inducing and killing mosquitoes and other insects, and the insect killing function is high. According to the planting method, ducks, carps and frogs are stocked into the field, not only insects are removed, and particularly, a biologic chain wherein mutualistic symbiosis of species and cyclic utilization are achieved is formed in the field. Duck manure is used for fertilizing the field so that fodder organisms are multiplied to be fed to ducks, and meanwhile the rice growth is also promoted. The organic rice is good in taste and high in nutrient content, and the organic rice in the mountainous area is full in seed and low in chaff and hull rate.
Owner:GUANGXI XIEJI AGRI DEV CO LTD

Traditional Chinese medicine pigeon feed capable of increasing laying rate

The invention provides traditional Chinese medicine pigeon feed capable of increasing the laying rate. The traditional Chinese medicine pigeon feed is prepared from pure grain feed and a traditional Chinese medicine additive; the pure grain feed is prepared from, by weight, 30-50 parts of corn, 8-12 parts of foxtail millet, 12-25 parts of wheat, 8-15 parts of sorghum and 22-28 parts of peas; the traditional Chinese medicine additive is prepared from, by weight, 8-15 parts of lycium barbarum, 2-8 parts of kochia scoparia, 6-13 parts of honeysuckle, 7-12 parts of fructus crataegi, 3-9 parts of herba epimedii, 5-12 parts of dandelion, 6-15 parts of radix acanthopanacis senticosi, 10-20 parts of radix astragali, 10-22 parts of cordate houttuynia, 5-15 parts of medicated leaven and 3-8 parts of codonopsis pilosula; the pure grain feed and the traditional Chinese medicine additive are proportioned according to the ratio of 100 to 0.5-1. According to the traditional Chinese medicine pigeon feed, the egg-laying pigeon feed additive is prepared from the purely natural Chinese herbal medicines, a pure grain feed formula is added, therefore, harm of chemical medicine to pigeons is avoided, and indirectly brought food safety problem is solved. The traditional Chinese medicine pigeon feed can greatly increase the survival rate of the pigeons, accelerate the growth of the pigeons, effectively improve the animal production performance, increase the laying rate and improve the egg quality.
Owner:YIBIN YUANHUA AGRI SCI & TECH DEV

Culture method for small and medium-sized litopenaeus vannamei

InactiveCN102893940AOvercome the shortcomings of large drainage and large irrigationGuarantee drug residueClimate change adaptationPisciculture and aquariaEnvironmental engineeringBiological organism
The invention relates to a culture method for small and medium-sized litopenaeus vannamei and belongs to the technical field of aquaculture. The culture method specifically comprises the following eight steps of: pond clearing, water introduction, disinfection, bait organism culture, water quality detection, staged shrimp seed putting, staged culture, and small and medium-sized catching and harvesting. The method adopts strict treatment such as secondary sedimentation, disinfection and secondary filtration for water for culture at each stage, one-time water introduction and sealed culture to effectively isolate the invasion of external pathogens, and does not use drugs during the whole culture process, so that the product does not have drug residues and has good quality; the staged shrimp seed putting adopts a method of pure-oxygen aeration and dry transportation by putting shrimp seed into a netting cage, with lower shrimp seed damage rate which is generally controlled below 1.0%; and a three-stage culture mode is adopted for culture and can realize 5-generation culture throughout the year, with the average yield of 750-1,000kg / mu, the culture success rate higher than that of conventional culture by 20-30%, and the output value increased by 50% compared with a conventional mode.
Owner:湛江新昶食品有限公司

Adsorption method for preparing soybean lecithin

The invention relates to an adsorption method for preparing soybean lecithin. Granulesten is taken as a raw material, C1-C4 alcohol is taken as a solvent, an adsorbent is added, the mixture is stirred, adsorbed and filtered, filtrate is subjected to desolvation under reduced pressure and vacuum drying to form a soybean lecithin product with over 80 percent of phosphatidylcholine, and the yield is over 85 percent. Compared with the conventional preparation method, the direct adsorptive separation technology has the advantages of simple process, short production period, high product purity, low consumption of solvent, simple equipment, low investment cost and the like, and is suitable for large-scale industrial production.
Owner:NANJING TECH UNIV

Grape cultivating method for reducing density, improving quality and promoting early maturing through single connected tent

The invention discloses a grape cultivating method for reducing density, improving quality and promoting early maturing through a single connected tent. The method comprises the construction and use of the single connected tent, frame changing and shaping, production reduction and quality improvement, standardized prevention of diseases and insect pests, improvement of soil fertility and improvement, reinforcement of small field ecological cycle by intercropping, integration of water and fertilizer, and digitization of filed groups; by adopting the method provided by the invention, grapes are planted in a dry-hot valley area, high efficiency, cost saving and application can be realized, and rain-shelter cultivation, intercropping, green control, the integration of water and fertilizer, 'three-zone shaping', disaster prevention and reduction, annual double cropping, yield control and quality improvement, soil improvement and planting and breeding can be combined; in addition, the conflict between grains and fields can be solved, the multiple cropping can be improved to improve the earnings; furthermore, the capacity of soil improvement and fertilizer improvement can be realized, the integration of water and fertilizer can be realized, the pesticide application can be reduced, and the quality safety and reliability of the grapes can be realized.
Owner:宾川县金牛镇农业综合服务中心

High-altitude lifting construction method for overweight steel truss of transferring layer

ActiveCN102979313ASolve the problem of high-altitude hoistingOvercome limitationsBuilding material handlingSuccessful completionTruck
The invention relates to a high-altitude lifting construction method for an overweight steel truss of a transferring layer. The high-altitude lifting construction method comprises the following steps of: firstly paving tracks on the floor at the lifting area of the transferring layer, then using a crane to lift a rod piece of the steel truss onto the tracks paved on the floor in advance, then arranging a guide pulley block, sliding the rod piece of the steel truss to be in position by the tracks, finally utilizing the matching of the pulley block and the crane, lifting the rod piece of the steel truss to the installing position and finishing the assembling construction. The innovative construction technology has the advantages that the high-altitude lifting difficulty in hoisting of a transferring truss is successfully solved, and the smooth and safe completion of the lifting operation in shortest time can be ensured. The high-altitude lifting construction method overcomes the limit of lifting of a large-tonnage truck crane adopted in the prior art, is safer and more reliable, can shorten the construction period and save the cost and the like, can lay the foundation for successful completion of a main engineering and is an optimal construction scheme for high-altitude lifting of the similar overweight steel truss of the transferring layer.
Owner:浙江省三建建设集团有限公司

Quick detection method for quality control of radix curcumae medicinal material

The invention discloses a near infrared spectroscopy detection method of a radix curcumae medicinal material. The method comprises near infrared detection of a water content, and / or, curdione, germacrone, and cincumol in radix curcumae. The method comprises the following steps: (1) preparation of a medicinal material sample, in which, a medicinal material is pulverized and sieved for later use; (2) target component detection, which comprises water content detection (through a methylbenzene method) or detection of curdione, germacrone, and cincumol (through a liquid phase method); (3) collection of near infrared spectroscopic data; (4) establishment of a quantitative model, in which, the near infrared spectroscopic data is associated with a known component content and the water content to establish the calibration quantitative model; and (5) near infrared detection of an unknown to-be-detected sample. The radix curcumae medicinal material can be quickly detected through the method; the method has advantages of simple operation and high accuracy; and the material is not wasted. Safe, efficient, controllable, and stable quality of the radix curcumae medicinal material is ensured.
Owner:WUXI JIMIN KEXIN SHANHE PHARMA

Linseed oil microcapsules and preparation method thereof

The invention discloses linseed oil microcapsules and a preparation method thereof. The preparation method comprises the following steps of (1) performing hydrolyzing and extracting by an enzyme method to obtain linseed oil; (2) preparing an aqueous phase; (3) preparing an oil phase; (4) performing high-speed cutting emulsifying on a mixture of the aqueous phase and the oil phase by a cutter; (5)performing homogenizing on obtained emulsion by a high pressure homogenizer; and (6) performing spray drying on the obtained emulsion to obtain linseed oil microcapsule granules. The linseed oil microcapsules are high in solubility, good in emulsibility, high in stability, good in film-forming properties and high in packing rate. The linseed oil microcapsules have good mouth feel and flavor, and are safe and reliable in quality; and besides, the preparation technology is simple, mass production is convenient, and the loading quantity of the obtained linseed oil microcapsule granule linseed oilcan achieve 42%, and the microcapsule entrapping rate is 90% or above.
Owner:广州利众生物科技有限公司

Method for producing fermented feed for mutton sheep from fresh corn stalks and pomace

The invention provides a method for producing a fermented feed for mutton sheep from fresh corn stalks and pomace. The fermented feed is produced from such raw materials as fresh corn stalks, pomace, corn meal, wheat shorts, calcium hydrophosphate, urea, microelement, vitamin, salt and beneficial microbial flora. All the raw materials are proportioned reasonably, smashed, rubbed and compacted, hermetically packaged with a plastic thin film by use of a special bundler and a coating machine, and finally fermented, and then the fermented feed for the mutton sheet can be obtained. The fresh corn stalk-pomace fermented feed is low in cost so that the mutton sheep breeding cost can be reduced; the silage is high in nutritive value and good in palatability; the raw materials are extremely easy to buy and low in cost, and the stalks can be comprehensively utilized and changed into things of value from waste; in short, the biological feed for the mutton sheep is low-carbon and environment-friendly.
Owner:李雷

Goose fermented feed and producing method thereof

The invention discloses a goose fermented feed and a producing method thereof. The producing method comprises the steps of: synthesizing corn, soy bean meal, wheat bran, wheat middling, rapeseed meal, pomace, trace elements, vitamins, table salt and beneficial microbial flora; removing impurities according to a rational proportion; grinding the materials into 80-100 meshes rough powders and mixing the powders; mixing mechanically and uniformly and cooling to pelletize; and sealing by plastic bag film, and packaging for warehousing, selling or standby application. Odor in the goose tongue can be changed and environment can be purified by using the goose fermented feed. Meanwhile, the goose fermented feed, disclosed by the invention, has the advantages of saving cost, being low in price, changing the waste into wealth to bring about obvious economic benefit as the raw materials of the goose fermented feed is extremely easy to purchase, being natural, green, ecological and environment-friendly, and having obvious function on preventing goose bowel diseases.
Owner:李雷

Method for fermentation production of tofu physalis alkekengi by using lactobacillus amylolyticus

The invention relates to a method for fermentation production of tofu physalis alkekengi by using lactobacillus amylolyticus, and belongs to the field of fermentation engineering. The method comprises the following steps: using a tofu yellow serofluid as a raw material, inoculating lactobacillus amylolyticus with the inoculation amount of 3%-10% (V / V) at the temperature of 30-40 DEG C, and performing fermentation for 36-48 hours to prepare a physalis alkekengi with the pH value of 4.0; using the prepared physalis alkekengi to produce physalis alkekengi tofu, wherein the use amount of the physalis alkekengi is 15%-20% (V / V). The preparation process of the physalis alkekengi comprises steps of preparation of yellow serofluid, sterilization, cooling, inoculation, cultivation, inspection and obtaining of a finished product. The method has the advantages that (1) safety hazards caused by pathogenic bacterium and the like in the natural physalis alkekengi fermentation process can be reduced to ensure quality safety; (2) tofu produced by the physalis alkekengi is strong in beam fragrant, and pure in taste; (3) the physalis alkekengi can be used in food processing production of physalis alkekengi noodles and the like; (4) the yellow serofluid in the beam processing process can be comprehensively used to reduce environmental pollution, while waste is converted into treasures to improve economic efficiency; (5) the production efficiency is high, the process is simple and the use is convenient.
Owner:HENAN UNIVERSITY OF TECHNOLOGY

Quality detection method for tibetan medicine rhododendron anthopogonoide and tibetan medicine rhododendron anthopogonoide preparation

The invention provides a quality detection method for tibetan medicine rhododendron anthopogonoide and a tibetan medicine rhododendron anthopogonoide preparation. The method includes: determining the total flavonoid content in the rhododendron anthopogonoide and the rhododendron anthopogonoide preparation by ultraviolet-spectrophotometry; simultaneously determining the total quercetin content in the rhododendron anthopogonoide and the rhododendron anthopogonoide preparation in the same chromatograph by high-performance liquid chromatography; and establishing a finger-print chromatogram of flavonoids in the rhododendron anthopogonoide and the rhododendron anthopogonoide preparation by the high-performance liquid chromatography. Therefore, quality of the rhododendron anthopogonoide and the rhododendron anthopogonoide preparation can be guaranteed by detecting whether common peaks exist in the finger-print chromatogram or not, and further medication safety for patients is guaranteed. The quality detection method is stable in sample solution, high in precision and excellent in reproducibility, has certain specificity, is good in separating effect of each characteristic constituent in the finger-print chromatogram, can be used for quality detection of rhododendron anthopogonoide medical materials, and is beneficial to guarantee of safety, effectiveness, controllability in quality and good clinical effect for the tibetan medicine rhododendron anthopogonoide and the tibetan medicine rhododendron anthopogonoide preparation.
Owner:SHANDONG JINHE DRUG RES DEV

Safe hydrogen-rich water glass

The invention relates to water glasses, in particular to safe hydrogen-rich water glass. The water glass comprises a water glass base, a water glass barrel and a water glass lid, wherein the water glass base comprises an electrolytic bath, a hydrogen dissolving device, solid activated carbon and a one-way dredging membrane; the electrolytic bath comprises a negative electrode, an ionic membrane, a positive electrode and an electrolytic bath controller; the negative electrode and the positive electrode which are contacted with drinking water are inlaid on the upper and lower sides of the ionic membrane, thus, an electrolytic bath core assembly is formed and mounted at the upper part of the water glass base through the one-way dredging membrane; the electrolytic bath core assembly is further connected with the electrolytic bath controller; the solid activated carbon is arranged below the electrolytic bath core assembly; the hydrogen dissolving device in connection control with a hydrogen dissolving device controller is arranged above the electrolytic bath core assembly; the water glass base and the water glass barrel are connected through a threaded structure; a filter element mounted on a filter element support is arranged in the water glass barrel. The safety of the quality of produced hydrogen-rich water bodies can be guaranteed and the safety in the risk aspect during usage can also be guaranteed.
Owner:SHANGHAI BIANJIE ENVIRONMENTAL PROTECTION TECH CO LTD

Nocardia seriolae fluorescence quantitative PCR detection kit and detection method

InactiveCN101962678AQuantitatively sensitiveSensitive quantitative PCR detectionMicrobiological testing/measurementFluorescence/phosphorescenceFluorescenceNucleotide sequencing
The invention discloses a nocardia seriolae fluorescence quantitative PCR detection kit and a nocardia seriolae fluorescence quantitative PCR detection method. The detection kit comprises 10.0 microliters of SYBRPremix ExTaqTM special agent, 10 micromol / L upstream primer solution and 0.8 microliters of downstream primer solution, and is characterized in that the nucleotide sequence of the upstream primer is 5,TGCTACAATGGCCGGTACAGAG3; and the nucleotide sequence of the downstream primer is 5,TTCACGAGGTCGAGTTGCAGAC3. The detection method comprises pathogenic bacteria extraction, pathogenic bacteria enzymolysis, DNA coarse extract preparation, DNA coarse extract purification and detection. The detection kit can detect nocardia seriolae in early stage sensitively, quickly, quantificationally and specifically. The sensitivity of the detection kit is up to 10 to 6 microgram / microliter, the quantification can be realized basically on the level of 10 to 5 microgram / microliter.
Owner:NINGBO UNIV

Pantoprazole sodium enteric-coated tablet and preparation method thereof

The invention provides a pantoprazole sodium enteric-coated tablet and a preparation method thereof. The pantoprazole sodium enteric-coated tablet comprises a pantoprazole sodium tablet, an isolated layer and an enteric-coated layer, wherein the pantoprazole sodium tablet comprises main drug pantoprazole sodium and auxiliaries; and the auxiliaries include a filler, a disintegrant, a lubricating agent, an adhesive, a pH regulating agent, and the like. The pantoprazole sodium enteric-coated tablet accelerates the disintegration time of the pantoprazole sodium enteric-coated tablet and solves the problem of drug instability during a storage period.
Owner:SHIJIAZHUANG HUAXIN PHARMA

Electric power engineering project site quality acceptance management method and system

The invention discloses a method and a system for site quality acceptance management of an electric power engineering project. The method comprises the following steps: a site acceptance personnel collects site quality data of items to be accepted by using a mobile terminal preset with a unified quality acceptance and evaluation standard, and performs acceptance evaluation on the items to be accepted; Transfer the collected site quality data and the corresponding evaluation results to the background server for the project quality inspection person in charge to check the implementation of acceptance work and feedback the acceptance work problems and the corresponding project rectification opinions; The on-site acceptance personnel shall, according to the received feedback acceptance work problems and the corresponding project rectification opinions, request the items to be accepted to make corresponding rectification, and feedback the rectification situation of the items to be acceptedby the mobile terminal. The invention realizes the on-site operation truly through the on-site operation of the mobile terminal, eliminates the phenomenon of 'two skins', makes the on-site operation control of the capital construction in place, executes each link according to the standard, and ensures the safe and high-quality construction of the engineering project.
Owner:FOSHAN POWER SUPPLY BUREAU GUANGDONG POWER GRID

Method for producing docosahexenoic acid by fermenting schizochytrium

The invention relates to a method for producing triglyceride type docosahexenoic acid fat by industrially fermenting schizochytrium. The method comprises the following step: the docosahexenoic acid fat is prepared by fermenting the schizochytrium taken as the strain with the a culture medium with microelements; wherein the culture medium with the microelements comprises a carbon source, a nitrogen source, inorganic salt and microelements, and the microelements comprise at least one of biotin, chlorophyll, beta-carotene, vitaminB1, vitaminB6 and vitaminB12. The prepared docosahexenoic acid fat does not need to be further chemically modified and can be directly used by people needing DHA, including infants, pregnant women, breast feeding women or patients who suffer from diseases due to insufficient DHA and need to supplement DHA. The invention has the advantages of high DHA content, high purity, safe and reliable quality, low production cost, stable production and almost no EPA; and the environmental-friendly, safe and high-content triglyceride type DHA fat can be produced with low cost at a large scale.
Owner:湖北福星生物科技有限公司

Preparation method of specific high-performance wear-resistant castable for coal burner

The invention discloses a preparation method of specific high-performance wear-resistant castable for a coal burner, which comprises the following steps that: (1) raw material which comprises corundum, carborundum, corundum powder, alumina powder, silica micro powder, pure calcium aluminate cement, stainless steel fiber, anti-explosion fiber and water reducing agent is homogenized; (2) the homogenized raw material is poured into a forced mixer to be mixed, dry material is put in at one step according to the capacity of the mixer to be dry mixed for 2 to 6min and added with water to be wet mixed for 4 to 8min, the input of the water is strictly controlled, so that the water is stably 4 to 5 percent of the total weight of the raw material; and (3) the product is naturally cured for more than 50h at 25DEG C of ambient temperature and stripped after being fully hardened. The product prepared by the preparation method is characterized by high temperature resistance, anti-erosion, wear resistance and other performance, and has long service life.
Owner:蒋美芳

Lotus plumule and new application of extractive thereof

InactiveCN101862374ARapid relief of obstructive symptomsTreatment for Seborrheic AlopeciaOrganic active ingredientsPharmaceutical delivery mechanism5 Alpha-Reductase InhibitorFood additive
The invention provides a new application of lotus plumule, in particular to the application of the lotus plumule, lotus plumule total alkaloid, bisbenzylisoquinoline-(7-0-11')-monoether key alkaloid derivant or analogue in preparing a drug or health care food of 5 alpha-reductase inhibitor. The invention also provides a 5 alpha-reductase inhibitor. The lotus plumule of the invention serves as the 5 alpha-reductase inhibitor and can serve as drug, health care food or food additive. The lotus plumule and the active ingredients thereof of the invention are used for inhibiting 5 alpha-reductase, can reduce prostate gland, can quickly remove the obstruction symptom of benign prostatic hyperplasia, can treat seborrheic alopecia and acne, has specific potency and controllable quality, is safe and provides a new option for clinic.
Owner:李宏

Quick detection method for Wangbi preparation dry intermediate multiple indexes

The invention relates to a quick detection method for Wangbi preparation dry intermediate multiple indexes. The method comprises the steps of: (1) determining the content of Wangbi intermediate standard preparation drying moisture, albiflorin, paeoniflorin, 5-O-methylvisammioside, icariin and Epimedin C in Wangbi preparation dry intermediate standard substances; (2) acquiring infrared diffuse reflection spectrums of the standard substances; (3) conducting pretreatment on the spectrums; (4) establishing a content prediction model by partial least square regression; (5) collecting the infrared diffuse reflection spectrum of a to-be-detected sample and performing pretreatment; and (6) substituting the pretreatment spectral data of the to-be-detected sample into the model obtained in step (4), thus acquiring predicted values of corresponding component contents. The method provided by the invention introduces the near infrared spectroscopic analysis technology into quality control of Wangbi preparation intermediates, realizes rapid determination of various quality control index contents, shortens the detection time, saves the production cost, improves the production efficiency and economic benefits, and ensures the safety and effectiveness of Wangbi tablets.
Owner:LIAONING HUANREN PHARMA

Reconstruction method for water-proof shell

The invention discloses a reconstruction method for a water-proof shell. The distribution condition of aquifers around an ore body is determined; reconstruction of the water-proof shell is performed in the aquifers; and a complete continuous water-proof key layer is formed around the ore body. The required thickness of a water-proof top plate is calculated in combination with an actual engineering condition and a mechanical principle. Whether damage occurs is judged by simulating water-proof shell stress, plastic zone and settlement distribution condition by utilizing Flac3d under an ore body mining condition. In engineering implementation, detection holes are firstly formed in the aquifers and positions of karst caves and fissures are determined by using a geological survey instrument, connection roadways are constructed in the aquifers around a middle section, and drilling and grouting underground chambers are constructed on parts of the roadway close to the fissures of the aquifers. Grouting holes are rationally arranged in the roadways and the underground chambers and encrypted grouting is performed, and finally, inter-hole CT (Computed Tomography) fluoroscopy is performed to check the grouting and water plugging effect. According to the method, a mine floor mining environment is reconstructed, so that mine floor mining is performed safely and efficiently, and geological disasters are effectively reduced.
Owner:CENT SOUTH UNIV

Flower dedicated functional biological liquid fertilizer and preparation method thereof

ActiveCN101913953BGuiding scientific and rational applicationQuality is safe and reliableFertilizer mixturesDiseaseNormal growth
The invention discloses a flower dedicated functional biological liquid fertilizer and a preparation method thereof. The flower dedicated functional biological liquid fertilizer is prepared through the following steps of: preparing clear liquid by separating biogas residues from biogas slurry obtained by fermenting livestock excrement through a methane tank; then degrading and adding photosynthetic bacterium strains to carry out amplification culture; and then mixing with chitosan, synergistic agents, trace element mixtures, nitrogen-phosphorus-potassium inorganic nutrients and natural plant essences in proportion. The flower dedicated functional biological liquid fertilizer has multiple functions of promoting rhizosphere soil substances of flowers to be transformed, improving the soil structures of potted flowers, enhancing the fertilizer preserving capability of soil, promoting the normal growth of the flowers, fixing nitrogen, enhancing the nitrogen level of the soil, promoting the proliferation of beneficial microorganisms of the soil, and participating in soil ecological substance circulation of the potted flowers together, and the like, prevents the troubles of turning over the soil and changing pots every year and reduces the labor intensity. The invention has small using amount of products, quick effect and long lasting effect, is mainly used for the spraying fertilization of the leaf surfaces of the flowers and the rushing fertilization of the roots of the flowers and enhances the cold resisting capability, the drought resisting capability and the disease resisting capability of the flowers and the fresh flower viewing period prolonging capability. The product plays a vital role on the regeneration utilization of finite resources, ecology protection and city garden environment beautification.
Owner:海安市园林绿化有限公司

Organic fertilizer for producing selenium-rich Siraitia grosvenorii and preparation method and use method therefor

The invention relates to an organic fertilizer for producing selenium-rich Siraitia grosvenorii. The organic fertilizer consists of the following components in percentages by weight: 30% to 40% of sheep manure, 15% to 20% of plant ash, 8% to 10% of biochemical yellow humic acid, 2% to 5% of diatomite, 2% to 5% of selenium ore powder, 5% to 8% of modified urea, 1% to 2% of potassium sulphate, 4% to 6% of calcium superphosphate, 8% to 15% of magnesium sulfate, 8% to 15% of boric acid, 2% to 5% of water-retaining agent and 5% to 6% of bacillus subtilis and yeast mixed bacteria. Moreover, the invention also provides a preparation method of the organic fertilizer for producing selenium-rich Siraitia grosvenorii and a use method thereof. The organic fertilizer has the beneficial effects that the organic fertilizer is low in cost, simple and convenient in operation, once root application is needed in the whole period of duration, the labor production cost is reduced, the produced Siraitia grosvenorii is safe in quality and high in content of organic selenium, and the organic fertilizer and the preparation method and the use method thereof can be widely applied in selenium-shortage areas or selenium-rich areas.
Owner:桂林永福福寿养生茶业有限公司

Installation and construction method of mechanical grate type waste incineration boiler

InactiveCN109000261AGive full consideration to reuseReduce the amount of work at heightIncinerator apparatusSteel frameSuperheater
The invention discloses an installation and construction method of a mechanical grate type waste incineration boiler. The installation and construction method includes the following specific steps ofconstruction preparation, specifically, unpacking inspection of boiler parts and equipment, retesting and paying off of boiler foundation, and configuration and installation of parallels; and installation and construction method, specifically, preparation and manufacturing of auxiliary tools, installation of boiler internal equipment, installation of rainproof shed, hydrostatic test of boiler, installation of boiler wall, steam tightness test of drying and boiling boiler, and safe trial operation, wherein the auxiliary tools includes a steel frame, a platform escalator, a temporary climbing ladder, an aisle guardrail, a temporary platform, a temporary platform guardrail, a scaffold lifting platform and a simple removable support, and the internal equipment includes a boiler grate, a watercooling system, a drum, a superheater and an economizer. The installation and construction method of the mechanical grate type waste incineration boiler is applicable to installation of the mechanicalgrate type waste incineration boiler with a daily garbage disposal of about 500t / d by a single unit in a domestic garbage power plant, the degree of mechanized construction is improved, the labor intensity is reduced, the project quality is guaranteed, the construction period is shortened, and the productivity and economic benefits are improved.
Owner:POWER CHINA HENAN ENG CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More