452results about How to "Quality is safe and reliable" patented technology

An extract of mulberry twigs is dislcosed, which can be used to prepare the food or the medicine to cure hyperuricemia and gout diseases. The said extract is prepared from mulberry twigs through extracting in solvent (aqueous solution of alcohol, chloroform, acetone, etc) at 10-100 deg.C more than one time, mergint the liquid extracts, recovering solvent, regulating pH value to 7.5-9.5, centrifugal separation to obtain supernatant, regulating pH value to 4-6, deposition, water washing wand drying. Several other approaches for purifying it are also disclosed.

The invention discloses a production process for wheat germ powder and belongs to the technical field of deep grain processing. Cordyceps militaris powder, walnut powder, pearl barley powder and bee pollen are adopted as auxiliary materials in the production process, wherein the mixture ratio of the cordyceps militaris powder to the walnut powder to the pearl barley powder to the bee pollen to the wheat germ powder in part by mass is 0.3-0.7 : 1.5-3 : 1.5-3 : 0.4-0.8 : 97-103. The production process comprises the steps as follows: filtering by a vibration sieve; deactivating enzyme and drying; conveying by a conveying belt; carrying out superfine grinding; sieving by an air jet sieve; carrying out three-dimensional mixing; carrying out microwave sterilization; and checking and packing. According to the production process, wheat germs are dried, subjected to enzyme deactivation, ground into ultrafine powder with fineness of 80-500 and subjected to microwave sterilization, so that the mouth feel of the wheat germ powder is improved, and the wheat germ powder with various wheat tastes and safe and reliable quality is produced.

The invention discloses a closed loop type fish and vegetable symbiosis system. The closed loop type fish and vegetable symbiosis system comprises a buffer pool, a fishpond, a sedimentation tank, a disinfection tank, a filter tank, a biofiltration tank, a hydroponic area, a fermenting tank and a dry-wet separation device. Fish manure and other waste generated by fish are subjected to sedimentation, disinfection, filtration, fermentation and other circular processing to be converted into nutrition required for vegetables. Oxygen generated by photosynthesis of the vegetables can be utilized by the fish, carbon dioxide generated by fish breathing provides a raw material for the photosynthesis of the vegetables, thereby efficiently utilizing water, gas, nutrition and other resources. Through reasonable layout and closed-loop design of each module of the system, the stability and running efficiency of the system are effectively improved, the hydroponic area corresponding to a water body ofeach unit is increased, the construction cost is reduced, the large-scale and commercialized promotion can be achieved; the closed loop type fish and vegetable symbiosis system avoids the problem of environment pollution possibly generated by aquaculture, can also harvest the fish and vegetables with considerable quantity and safe quality, thereby satisfying the demands of people for food safety,environmental protection and other aspects.

The invention provides traditional Chinese medicine pigeon feed capable of increasing the laying rate. The traditional Chinese medicine pigeon feed is prepared from pure grain feed and a traditional Chinese medicine additive; the pure grain feed is prepared from, by weight, 30-50 parts of corn, 8-12 parts of foxtail millet, 12-25 parts of wheat, 8-15 parts of sorghum and 22-28 parts of peas; the traditional Chinese medicine additive is prepared from, by weight, 8-15 parts of lycium barbarum, 2-8 parts of kochia scoparia, 6-13 parts of honeysuckle, 7-12 parts of fructus crataegi, 3-9 parts of herba epimedii, 5-12 parts of dandelion, 6-15 parts of radix acanthopanacis senticosi, 10-20 parts of radix astragali, 10-22 parts of cordate houttuynia, 5-15 parts of medicated leaven and 3-8 parts of codonopsis pilosula; the pure grain feed and the traditional Chinese medicine additive are proportioned according to the ratio of 100 to 0.5-1. According to the traditional Chinese medicine pigeon feed, the egg-laying pigeon feed additive is prepared from the purely natural Chinese herbal medicines, a pure grain feed formula is added, therefore, harm of chemical medicine to pigeons is avoided, and indirectly brought food safety problem is solved. The traditional Chinese medicine pigeon feed can greatly increase the survival rate of the pigeons, accelerate the growth of the pigeons, effectively improve the animal production performance, increase the laying rate and improve the egg quality.

The invention relates to a culture method for small and medium-sized litopenaeus vannamei and belongs to the technical field of aquaculture. The culture method specifically comprises the following eight steps of: pond clearing, water introduction, disinfection, bait organism culture, water quality detection, staged shrimp seed putting, staged culture, and small and medium-sized catching and harvesting. The method adopts strict treatment such as secondary sedimentation, disinfection and secondary filtration for water for culture at each stage, one-time water introduction and sealed culture to effectively isolate the invasion of external pathogens, and does not use drugs during the whole culture process, so that the product does not have drug residues and has good quality; the staged shrimp seed putting adopts a method of pure-oxygen aeration and dry transportation by putting shrimp seed into a netting cage, with lower shrimp seed damage rate which is generally controlled below 1.0%; and a three-stage culture mode is adopted for culture and can realize 5-generation culture throughout the year, with the average yield of 750-1,000kg/mu, the culture success rate higher than that of conventional culture by 20-30%, and the output value increased by 50% compared with a conventional mode.

The invention discloses a grape cultivating method for reducing density, improving quality and promoting early maturing through a single connected tent. The method comprises the construction and use of the single connected tent, frame changing and shaping, production reduction and quality improvement, standardized prevention of diseases and insect pests, improvement of soil fertility and improvement, reinforcement of small field ecological cycle by intercropping, integration of water and fertilizer, and digitization of filed groups; by adopting the method provided by the invention, grapes are planted in a dry-hot valley area, high efficiency, cost saving and application can be realized, and rain-shelter cultivation, intercropping, green control, the integration of water and fertilizer, 'three-zone shaping', disaster prevention and reduction, annual double cropping, yield control and quality improvement, soil improvement and planting and breeding can be combined; in addition, the conflict between grains and fields can be solved, the multiple cropping can be improved to improve the earnings; furthermore, the capacity of soil improvement and fertilizer improvement can be realized, the integration of water and fertilizer can be realized, the pesticide application can be reduced, and the quality safety and reliability of the grapes can be realized.

The invention relates to a high-altitude lifting construction method for an overweight steel truss of a transferring layer. The high-altitude lifting construction method comprises the following steps of: firstly paving tracks on the floor at the lifting area of the transferring layer, then using a crane to lift a rod piece of the steel truss onto the tracks paved on the floor in advance, then arranging a guide pulley block, sliding the rod piece of the steel truss to be in position by the tracks, finally utilizing the matching of the pulley block and the crane, lifting the rod piece of the steel truss to the installing position and finishing the assembling construction. The innovative construction technology has the advantages that the high-altitude lifting difficulty in hoisting of a transferring truss is successfully solved, and the smooth and safe completion of the lifting operation in shortest time can be ensured. The high-altitude lifting construction method overcomes the limit of lifting of a large-tonnage truck crane adopted in the prior art, is safer and more reliable, can shorten the construction period and save the cost and the like, can lay the foundation for successful completion of a main engineering and is an optimal construction scheme for high-altitude lifting of the similar overweight steel truss of the transferring layer.

The invention discloses a near infrared spectroscopy detection method of a radix curcumae medicinal material. The method comprises near infrared detection of a water content, and/or, curdione, germacrone, and cincumol in radix curcumae. The method comprises the following steps: (1) preparation of a medicinal material sample, in which, a medicinal material is pulverized and sieved for later use; (2) target component detection, which comprises water content detection (through a methylbenzene method) or detection of curdione, germacrone, and cincumol (through a liquid phase method); (3) collection of near infrared spectroscopic data; (4) establishment of a quantitative model, in which, the near infrared spectroscopic data is associated with a known component content and the water content to establish the calibration quantitative model; and (5) near infrared detection of an unknown to-be-detected sample. The radix curcumae medicinal material can be quickly detected through the method; the method has advantages of simple operation and high accuracy; and the material is not wasted. Safe, efficient, controllable, and stable quality of the radix curcumae medicinal material is ensured.

The invention discloses linseed oil microcapsules and a preparation method thereof. The preparation method comprises the following steps of (1) performing hydrolyzing and extracting by an enzyme method to obtain linseed oil; (2) preparing an aqueous phase; (3) preparing an oil phase; (4) performing high-speed cutting emulsifying on a mixture of the aqueous phase and the oil phase by a cutter; (5)performing homogenizing on obtained emulsion by a high pressure homogenizer; and (6) performing spray drying on the obtained emulsion to obtain linseed oil microcapsule granules. The linseed oil microcapsules are high in solubility, good in emulsibility, high in stability, good in film-forming properties and high in packing rate. The linseed oil microcapsules have good mouth feel and flavor, and are safe and reliable in quality; and besides, the preparation technology is simple, mass production is convenient, and the loading quantity of the obtained linseed oil microcapsule granule linseed oilcan achieve 42%, and the microcapsule entrapping rate is 90% or above.

The invention relates to a method for fermentation production of tofu physalis alkekengi by using lactobacillus amylolyticus, and belongs to the field of fermentation engineering. The method comprises the following steps: using a tofu yellow serofluid as a raw material, inoculating lactobacillus amylolyticus with the inoculation amount of 3%-10% (V/V) at the temperature of 30-40 DEG C, and performing fermentation for 36-48 hours to prepare a physalis alkekengi with the pH value of 4.0; using the prepared physalis alkekengi to produce physalis alkekengi tofu, wherein the use amount of the physalis alkekengi is 15%-20% (V/V). The preparation process of the physalis alkekengi comprises steps of preparation of yellow serofluid, sterilization, cooling, inoculation, cultivation, inspection and obtaining of a finished product. The method has the advantages that (1) safety hazards caused by pathogenic bacterium and the like in the natural physalis alkekengi fermentation process can be reduced to ensure quality safety; (2) tofu produced by the physalis alkekengi is strong in beam fragrant, and pure in taste; (3) the physalis alkekengi can be used in food processing production of physalis alkekengi noodles and the like; (4) the yellow serofluid in the beam processing process can be comprehensively used to reduce environmental pollution, while waste is converted into treasures to improve economic efficiency; (5) the production efficiency is high, the process is simple and the use is convenient.

The invention provides a quality detection method for tibetan medicine rhododendron anthopogonoide and a tibetan medicine rhododendron anthopogonoide preparation. The method includes: determining the total flavonoid content in the rhododendron anthopogonoide and the rhododendron anthopogonoide preparation by ultraviolet-spectrophotometry; simultaneously determining the total quercetin content in the rhododendron anthopogonoide and the rhododendron anthopogonoide preparation in the same chromatograph by high-performance liquid chromatography; and establishing a finger-print chromatogram of flavonoids in the rhododendron anthopogonoide and the rhododendron anthopogonoide preparation by the high-performance liquid chromatography. Therefore, quality of the rhododendron anthopogonoide and the rhododendron anthopogonoide preparation can be guaranteed by detecting whether common peaks exist in the finger-print chromatogram or not, and further medication safety for patients is guaranteed. The quality detection method is stable in sample solution, high in precision and excellent in reproducibility, has certain specificity, is good in separating effect of each characteristic constituent in the finger-print chromatogram, can be used for quality detection of rhododendron anthopogonoide medical materials, and is beneficial to guarantee of safety, effectiveness, controllability in quality and good clinical effect for the tibetan medicine rhododendron anthopogonoide and the tibetan medicine rhododendron anthopogonoide preparation.

The invention discloses a nocardia seriolae fluorescence quantitative PCR detection kit and a nocardia seriolae fluorescence quantitative PCR detection method. The detection kit comprises 10.0 microliters of SYBRPremix ExTaqTM special agent, 10 micromol/L upstream primer solution and 0.8 microliters of downstream primer solution, and is characterized in that the nucleotide sequence of the upstream primer is 5,TGCTACAATGGCCGGTACAGAG3; and the nucleotide sequence of the downstream primer is 5,TTCACGAGGTCGAGTTGCAGAC3. The detection method comprises pathogenic bacteria extraction, pathogenic bacteria enzymolysis, DNA coarse extract preparation, DNA coarse extract purification and detection. The detection kit can detect nocardia seriolae in early stage sensitively, quickly, quantificationally and specifically. The sensitivity of the detection kit is up to 10 to 6 microgram/ microliter, the quantification can be realized basically on the level of 10 to 5 microgram/microliter.

The invention provides a pantoprazole sodium enteric-coated tablet and a preparation method thereof. The pantoprazole sodium enteric-coated tablet comprises a pantoprazole sodium tablet, an isolated layer and an enteric-coated layer, wherein the pantoprazole sodium tablet comprises main drug pantoprazole sodium and auxiliaries; and the auxiliaries include a filler, a disintegrant, a lubricating agent, an adhesive, a pH regulating agent, and the like. The pantoprazole sodium enteric-coated tablet accelerates the disintegration time of the pantoprazole sodium enteric-coated tablet and solves the problem of drug instability during a storage period.

The invention discloses a preparation method of specific high-performance wear-resistant castable for a coal burner, which comprises the following steps that: (1) raw material which comprises corundum, carborundum, corundum powder, alumina powder, silica micro powder, pure calcium aluminate cement, stainless steel fiber, anti-explosion fiber and water reducing agent is homogenized; (2) the homogenized raw material is poured into a forced mixer to be mixed, dry material is put in at one step according to the capacity of the mixer to be dry mixed for 2 to 6min and added with water to be wet mixed for 4 to 8min, the input of the water is strictly controlled, so that the water is stably 4 to 5 percent of the total weight of the raw material; and (3) the product is naturally cured for more than 50h at 25DEG C of ambient temperature and stripped after being fully hardened. The product prepared by the preparation method is characterized by high temperature resistance, anti-erosion, wear resistance and other performance, and has long service life.

The invention provides a new application of lotus plumule, in particular to the application of the lotus plumule, lotus plumule total alkaloid, bisbenzylisoquinoline-(7-0-11')-monoether key alkaloid derivant or analogue in preparing a drug or health care food of 5 alpha-reductase inhibitor. The invention also provides a 5 alpha-reductase inhibitor. The lotus plumule of the invention serves as the 5 alpha-reductase inhibitor and can serve as drug, health care food or food additive. The lotus plumule and the active ingredients thereof of the invention are used for inhibiting 5 alpha-reductase, can reduce prostate gland, can quickly remove the obstruction symptom of benign prostatic hyperplasia, can treat seborrheic alopecia and acne, has specific potency and controllable quality, is safe and provides a new option for clinic.

The invention discloses a reconstruction method for a water-proof shell. The distribution condition of aquifers around an ore body is determined; reconstruction of the water-proof shell is performed in the aquifers; and a complete continuous water-proof key layer is formed around the ore body. The required thickness of a water-proof top plate is calculated in combination with an actual engineering condition and a mechanical principle. Whether damage occurs is judged by simulating water-proof shell stress, plastic zone and settlement distribution condition by utilizing Flac3d under an ore body mining condition. In engineering implementation, detection holes are firstly formed in the aquifers and positions of karst caves and fissures are determined by using a geological survey instrument, connection roadways are constructed in the aquifers around a middle section, and drilling and grouting underground chambers are constructed on parts of the roadway close to the fissures of the aquifers. Grouting holes are rationally arranged in the roadways and the underground chambers and encrypted grouting is performed, and finally, inter-hole CT (Computed Tomography) fluoroscopy is performed to check the grouting and water plugging effect. According to the method, a mine floor mining environment is reconstructed, so that mine floor mining is performed safely and efficiently, and geological disasters are effectively reduced.

The invention relates to an organic fertilizer for producing selenium-rich Siraitia grosvenorii. The organic fertilizer consists of the following components in percentages by weight: 30% to 40% of sheep manure, 15% to 20% of plant ash, 8% to 10% of biochemical yellow humic acid, 2% to 5% of diatomite, 2% to 5% of selenium ore powder, 5% to 8% of modified urea, 1% to 2% of potassium sulphate, 4% to 6% of calcium superphosphate, 8% to 15% of magnesium sulfate, 8% to 15% of boric acid, 2% to 5% of water-retaining agent and 5% to 6% of bacillus subtilis and yeast mixed bacteria. Moreover, the invention also provides a preparation method of the organic fertilizer for producing selenium-rich Siraitia grosvenorii and a use method thereof. The organic fertilizer has the beneficial effects that the organic fertilizer is low in cost, simple and convenient in operation, once root application is needed in the whole period of duration, the labor production cost is reduced, the produced Siraitia grosvenorii is safe in quality and high in content of organic selenium, and the organic fertilizer and the preparation method and the use method thereof can be widely applied in selenium-shortage areas or selenium-rich areas.