Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nocardia seriolae fluorescence quantitative PCR detection kit and detection method

A technology of detection kits for Nocardia spp., applied in fluorescence/phosphorescence, measurement/inspection of microorganisms, biochemical equipment and methods, etc., which can solve problems such as difficulties in detection and prevention of fish diseases

Inactive Publication Date: 2012-09-05
NINGBO UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

We have found the pathogen in large yellow croakers cultured in seawater and snakeheads cultured in freshwater. Since the pathogen resides in the internal organs (liver, spleen, kidney, heart, etc.) of animals, the main symptom is white nodules appearing in internal organs, and early There are no obvious symptoms on the surface, which brings difficulties to the detection and control of fish diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nocardia seriolae fluorescence quantitative PCR detection kit and detection method
  • Nocardia seriolae fluorescence quantitative PCR detection kit and detection method
  • Nocardia seriolae fluorescence quantitative PCR detection kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Yellowtail Nocardia Fluorescent Quantitative PCR Detection Kit: Including SYBR Premix Ex Taq TM (2×) 10.0 μl of special reagent, 0.8 μl of upstream primer solution and downstream primer solution with a concentration of 10 μM, the nucleotide sequence of upstream primer is: 5 ， TGCTACAATG GCCGGTACAG AG 3 ， , the nucleotide sequence of the downstream primer is: 5 ， TTCACGAGGT CGAGTTGCAG AC 3 ， , the upstream and downstream primers were designed according to the transcriptional spacer sequence in the 16S–23S rRNA gene of Nocardia japonica, and were synthesized by Shanghai Sangon Bioengineering Co., Ltd.

[0020] Preparation of standard Nocardia spp. template DNA: Place 1.5ml of the cultured Nocardia spp. suspension in a microcentrifuge tube and centrifuge at 6000 rpm for 5 min, discard the supernatant, and dissolve the obtained precipitate in 450 μl Add 20 μl of lysozyme with a concentration of 50 mg / ml to the TE Buffer solution, place it in a water bath at 37°C for 2...

Embodiment 2

[0023] Substantially the same as Example 1, the only difference is that the concentration of the Nocardia dna template standard solution of the yellowtail is 10 -2 μg / μl, amplification curve and melting curve are basically the same as in Example 1.

Embodiment 3

[0025] Substantially the same as Example 1, the only difference is that the concentration of the Nocardia dna template standard solution of the yellowtail is 10 -3 μg / μl,

[0026] The amplification curve and melting curve are basically the same as in Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a nocardia seriolae fluorescence quantitative PCR detection kit and a nocardia seriolae fluorescence quantitative PCR detection method. The detection kit comprises 10.0 microliters of SYBRPremix ExTaqTM special agent, 10 micromol / L upstream primer solution and 0.8 microliters of downstream primer solution, and is characterized in that the nucleotide sequence of the upstream primer is 5,TGCTACAATGGCCGGTACAGAG3; and the nucleotide sequence of the downstream primer is 5,TTCACGAGGTCGAGTTGCAGAC3. The detection method comprises pathogenic bacteria extraction, pathogenic bacteria enzymolysis, DNA coarse extract preparation, DNA coarse extract purification and detection. The detection kit can detect nocardia seriolae in early stage sensitively, quickly, quantificationally and specifically. The sensitivity of the detection kit is up to 10 to 6 microgram / microliter, the quantification can be realized basically on the level of 10 to 5 microgram / microliter.

Description

technical field [0001] The invention relates to a detection reagent for the yellowtail Nocardia, in particular to a fluorescent quantitative PCR detection kit and a detection method for the yellowtail Nocardia. Background technique [0002] Yellowtail Nocardia ( Nocardia seriolea ) is a pathogenic bacterium discovered in recent years in animals such as fish, shellfish and crustaceans. The rate is as high as 40%, and the average death rate is 35%. We have found the pathogen in large yellow croakers cultured in seawater and snakeheads cultured in freshwater. Since the pathogen resides in the internal organs (liver, spleen, kidney, heart, etc.) of animals, the main symptom is white nodules appearing in internal organs, and early There are no obvious symptoms on the surface, which brings difficulties to the detection and prevention of fish diseases. Therefore, it is particularly important and urgent to establish the detection technology of Nocardia spp. in yellowtail, especia...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/06G01N21/64
Inventor 王国良刘璐李思源
Owner NINGBO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com