Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for detecting relevant expression quantity of AML-EVI1 (acute myelocytic leukemia-ecotropic virus integration site 1) fusion gene

A technology of relative expression and fusion gene, applied in the field of gene detection kits, can solve the problems of inferior specificity and high cost, and achieve the effects of simple operation, lower detection cost, and improved detection accuracy.

Active Publication Date: 2012-11-14
WUHAN ADICON CLINICAL LAB
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, because SYBR GreenI is an unsaturated dye, its specificity is not as good as that of the double-probe hybridization method and the Taqman method, and its specificity must be judged by observing the melting curve; and the cost of the double-probe hybridization method is relatively expensive.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting relevant expression quantity of AML-EVI1 (acute myelocytic leukemia-ecotropic virus integration site 1) fusion gene
  • Kit for detecting relevant expression quantity of AML-EVI1 (acute myelocytic leukemia-ecotropic virus integration site 1) fusion gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] The kit for detecting the relative expression of AML1-EVI1 fusion gene of the present invention comprises:

[0026] Red blood cell lysate;

[0027] TRIzol;

[0028] Chloroform;

[0029] Anhydrous ethanol;

[0030] Detection system PCR reaction solution: ReverTra Ace qPCR RT Kit (TOYOBO); THNDERBIRD Probe qPCR Mix (2×), AML1-EVI1 upstream and downstream primers 0.8 uM each, AML1-EVI1 probe 0.4 uM; abl upstream and downstream primers each 0.8uM, abl-probe (probe) 0.4uM;

[0031] Among them: AML1-EVI1-F: GACCATCACTGTCTTCA;

[0032] AML1-EVI1-R: AGTCTTCGCAGCGATAT;

[0033]AML1-EVI1-Probe: FAM-AATCACAGTGGATGGGCCCCGAG-TAMRA;

[0034] abl-F: GCCGTGAAGACCTTGAAGGAG;

[0035] abl-R: ATGATATAGAACGGGGGCTC;

[0036] abl-Probe: FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA;

[0037] Positive control substance: solution containing AML1-EVI1 genome; negative control substance: solution without AML1-EVI1 genome.

Embodiment 2

[0039] The using method of kit of the present invention:

[0040] (1) Extract tissue RNA from blood: Add 1ml of erythrocyte lysate to a clean 1.5ml centrifuge tube, take 0.5ml of anticoagulated blood and mix well. Let stand at room temperature for 10 minutes; centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 0.5ml red blood cell lysate again, centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 1ml TRIzol to the cells, and pipette repeatedly until sedimentation Dissolve completely, let stand at room temperature for 5 minutes; add 0.2ml chloroform, shake evenly; centrifuge at 14000rpm 4°C for 10 minutes, absorb the supernatant layer and transfer to another new centrifuge tube; add an equal volume of isopropanol, mix well up and down, stand at room temperature Centrifuge at 14000rpm at 4°C for 10min, discard the supernatant, add 1ml of 75% ethanol, wash the tube wall upside down gently; ...

Embodiment 3

[0050] Using the nucleic acid detection kit of the present invention to detect clinical specimens

[0051] A total of 80 cases of anticoagulated blood samples from patients with chronic myelogenous leukemia (CML) submitted for inspection were taken, and genomic RNA was extracted, reagents were prepared and tested according to the method described in Example 2.

[0052] Add 2ul of each sample to the detection system PCR reaction solution. At the same time, make a standard curve of positive, negative, blank control, and internal reference gene / target gene. A 96-well fluorescent PCR instrument can detect 38 samples at the same time, each sample has 2 repetitions, a positive control, a negative control and a blank control. The detection time is only 100 minutes.

[0053] The experimental results are compared with the results reported by the special inspection laboratory to determine the accuracy of the sample detection. Some positive results are as follows:

[0054] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting relevant expression quantity of an AML-EVI1 (acute myelocytic leukemia-ecotropic virus integration site-1) fusion gene. The kit comprises red blood cell lysis buffer, TRIzol, chloroform, absolute ethyl alcohol, RevertraAceqPCRRTKit, detecting system PCR (polymerase chain reaction) liquid, a positive reference substance and a negative reference substance. The kit is characterized in that the detecting system PCR reaction liquid comprises THUNDERBIRDqPCRMIX; a target gene is detected via upstream and downstream primers AML1-EVI1-F and AML1-EVI1-R and a probe AML1-EVI1-Probe; and an internal control gene Abl is detected via primers abl-F and abl-R and a probe abl-Probe. The kit disclosed by the invention can detect the expression level of the AML1-EVI1 fusion engine in a patient body subjected to CML (chronicmyelognousleukemia), thus, the detecting time can be effectively salved, and the detecting precision can be increased.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, in particular to a gene detection kit, which can detect the AML1-EVI1 fusion gene in human chronic myelogenous leukemia (chronic myelognous leukemia, CML) patients by using probe real-time fluorescence quantitative PCR technology Detection of expression levels can effectively save detection time and improve detection accuracy. Background technique [0002] Leukemia is a kind of clonal malignant disease with abnormal hematopoietic stem cells. In the bone marrow and other hematopoietic tissues, a large number of leukemia cells proliferate and accumulate and infiltrate other organs and tissues, and at the same time inhibit normal hematopoiesis. The clinical manifestations are anemia, bleeding, infection and infiltration of various organs. According to the degree of maturity of leukemia cells and the natural course of the disease, leukemia can be divided into two categories: acute and c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 周晓犊王淑一徐建成
Owner WUHAN ADICON CLINICAL LAB
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More