Preparation and application method of a genetically engineered bacterium expressing thymosin β4

A technology of genetically engineered bacteria and thymosin, which is applied to hormone peptides, introduction of foreign genetic material using vectors, animal/human proteins, etc., can solve the problems of high cost of thymosin β4 and many types of impurities, and achieve low cost and purification technology. Simple, cost-friendly effect

Inactive Publication Date: 2016-03-09
SHANGHAI ENTS BIOTECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the cost of solid-phase synthesis of thymosin β4 is also high, and there are many types of impurities

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation and application method of a genetically engineered bacterium expressing thymosin β4
  • Preparation and application method of a genetically engineered bacterium expressing thymosin β4
  • Preparation and application method of a genetically engineered bacterium expressing thymosin β4

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0017] The method for preparing a genetically engineered bacterium expressing thymosin β4 provided by the present invention comprises the following steps: step 1, synthesizing a thymosin β4 (Tβ4) gene sequence that can be highly expressed in Escherichia coli; step 2, converting the gene obtained in step 1 Recombine into the pTWIN1 plasmid vector digested with shrimp alkaline phosphatase I (SapI) to obtain the pTWIN-Tβ4 fusion vector; step 3, use the pTWIN-Tβ4 obtained in step 2 as a template, and PCR amplify the intein on the vector sequence and Tβ4 sequence; step 4, recombine the gene sequence obtained in step 3 into the plasmid pET-28a digested with restriction endonuclease NcoI and XhoI to obtain the pET-Tβ4 expression vector; step 5, recombine the obtained gene sequence in step 4 Transform pET-Tβ4 into competent Escherichia coli cells BL21 to obtain pET-Tβ4 engineering bacteria; step 6, the OD of the pET-Tβ4 engineering bacteria liquid 600 At a value of 0.4-0.6, the additi...

Embodiment 1

[0020] 1. Acquisition of thymosin β4 gene.

[0021] According to the sequence published by NCBI (NM_021109.3) and the preferred codons of Escherichia coli, the thymosin β4 gene sequence that can be highly expressed in Escherichia coli was designed, and the following two single strands were synthesized by Gene Synthesis Company.

[0022] Single chain 1:

[0023] TCTGACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAACTGAAGAAGACAGAGACGCAAGAGAAAAATCCACTGCCTTCCAAAGAAACGATTGAACAGGAGAAGCAAGCAGGCGAATCG.

[0024] Single chain 2:

[0025] CGATTCGCCTGCTTGCTTCTCCTGTTCAATCGTTTCTTTGGAAGGCAGTGGATTTTTCTCTTGCGTCTCTGTCTTTCAGTTTCGACTTATCGAATTTCTCGATCTCAGCCATATCGGGTTTGTCAGA.

[0026] After synthesis, the two single strands were annealed at 55°C for 30 minutes to obtain the whole gene of thymosin β4.

[0027] 2. Construction of fusion vector pTWIN-Tβ4.

[0028] The pTWIN1 plasmid was digested with SapI, and the gel was recovered. The Tβ4 gene was ligated with the pTWIN1 plasmid according to the fol...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation and application method of a genetically engineered bacterium expressing thymosin β4, comprising: step 1, synthesizing a thymosin β4 gene sequence that can be highly expressed in Escherichia coli; step 2, recombining the gene obtained in step 1 Enter the Sap? I digested pTWIN? 1 plasmid vector to obtain pTWIN-Tβ4 fusion vector; step 3, using the obtained pTWIN-Tβ4 as a template, PCR amplifies the intein sequence and Tβ4 sequence on the vector; step 4, recombining the obtained gene sequence into Nco ? I, Xho? In the plasmid pET-28a of I digestion, obtain pET-Tβ4 expression vector; Step 5, the carrier of gain is transformed in the competent escherichia coli cell BL21, obtains pET-Tβ4 engineering bacterium; Step 6, in the OD600 of gained bacterium liquid When the value is 0.4-0.6, adding IPTG induces Tβ4 expression. The invention also discloses an application method of the gene engineering bacteria expressing thymosin β4. The preparation and application method of the genetically engineered bacteria expressing thymosin β4 provided by the invention lays a foundation for low-cost and environment-friendly production of thymosin β4.

Description

technical field [0001] The invention relates to a preparation and application method of a genetic engineering bacterium, in particular to a preparation and application method of a genetic engineering bacterium expressing thymosin β4. Background technique [0002] Thymosin β4 (Thymosinbeta4, Tβ4) is an acidic polypeptide composed of 43 amino acids, the amino group of the first amino acid Ser at the N-terminus is modified by acetylation, and there is no disulfide bond. Its amino acid sequence is as follows: Ac-Ser-Asp-Lys-Pro-Asp-Met-Ala-Glu-Ile-Glu-Lys-Phe-Asp-Lys-Ser-Lys-Leu-Lys-Lys-Thr-Glu-Thr - Gln-Glu-Lys-Asn-Pro-Leu-Pro-Ser-Lys-Glu-Thr-Ile-Glu-Gln-Glu-Lys-Gln-Ala-Gly-Glu-Ser. Thymosin β4 has a molecular weight of 4964 Da and an isoelectric point of 5.1. [0003] Thymosin β4 is a multifunctional factor that can regulate the polymerization and depolymerization of actin, and can promote skin wound healing, corneal injury repair, nerve injury repair, anti-inflammation, pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/70C07K14/575
Inventor李敏陈福鼎
OwnerSHANGHAI ENTS BIOTECH