Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for expressing and purifying simultaneous exons 3 and 5 deficient alpha synuclein alternative spliceosome protein

A synuclein and exon deletion technology, applied in the field of expression and purification of α-synuclein-selective spliceosome protein in E.coli, can solve the problem of time-consuming and expensive, and achieve good parallel effect , high output, simple operation effect

Active Publication Date: 2015-06-17
INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to overcome the disadvantages of time-consuming and cost-intensive protein purification in the prior art, and provide an efficient and rapid method for purifying and expressing an alternative splice body of α-synuclein that simultaneously lacks exons 3 and 5

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing and purifying simultaneous exons 3 and 5 deficient alpha synuclein alternative spliceosome protein
  • Method for expressing and purifying simultaneous exons 3 and 5 deficient alpha synuclein alternative spliceosome protein
  • Method for expressing and purifying simultaneous exons 3 and 5 deficient alpha synuclein alternative spliceosome protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: A method for expressing and purifying an alternatively spliced ​​body of α-synuclein lacking exons 3 and 5, characterized in that the method specifically includes the following steps:

[0030] Step 1: Acquisition of α-synuclein alternatively spliced ​​gene with deletion of exons 3 and 5 at the same time:

[0031] Amplification primers are as follows (the underline represents the restriction site):

[0032] Left F: AA CCCGGG TATGGATGTATTCATG;

[0033] EN3A: GGTCTTCTCAGCCACTACATAGAGAACACC;

[0034] RightEN3B: GGTGTTCTCTATGTAGTGGCTGAGAAGACC;

[0035] EN5: TTT GCGGCCGC GGCTTCAGGTTCGTAGTCTTGATACCCTTCCTTGC

[0036] CCAACTGGTCCTT;

[0037] The amplification conditions were pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, 35 cycles, and finally extension at 72°C for 10 min.

[0038] The second step, recombinant vector construction:

[0039] According to the reagent instructions, use ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for expressing and purifying a simultaneous exons 3 and 5 deficient alpha synuclein alternative spliceosome protein belongs to the technical field of biology, and a method for expressing the simultaneously exons 3 and 5 deficient alpha synuclein alternative spliceosome protein in an E.coli body and purifying the protein. The method comprises the steps of obtaining of the cDNA of the simultaneous exons 3 and 5 deficient alpha synuclein, vector construction, induced expression of protein, GST-alpha-syndelta3delta5 purification and GST label removal. The method can be used for realizing the in-vitro expression of the simultaneous exons 3 and 5 deficient alpha synuclein alternative spliceosome protein; as a result, a foundation is laid for the in-vitro study of the gathering characteristic, cytotoxicity and transfer characteristic of the protein and the construction of an animal model of the simultaneous exons 3 and 5 deficient alpha synuclein alternative spliceosome protein, and a method is provided for deep studying the correlation of the protein to the pathogenic mechanism of Parkinson disease.

Description

technical field [0001] The invention belongs to the field of biotechnology, and is an alternatively spliced ​​alpha-synuclein protein that simultaneously deletes exons 3 and 5. E. coli In vivo expression and purification methods. Background technique [0002] Parkinson's disease is the second most common neurodegenerative disease after Alzheimer's disease, and its typical pathological features are the progressive degeneration of midbrain dopaminergic neurons and the appearance of Lewy bodies. As a key protein in the pathogenesis of Parkinson's disease - α-synuclein (α-syn), its abnormal aggregates are not only the main component of Lewy bodies, but also closely related to several cellular processes related to neurodegeneration . Studies have confirmed that gene polymorphism changes mediated by alternative splicing of α-synuclein gene play an important role in the pathogenesis of sporadic PD. α-synuclein is composed of 140 amino acids and is widely expressed in the presyna...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/12C07K14/47
Inventor 马开利吴正存黄璋琼江勤芳高家红李聪罕园园李云
Owner INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI