Reagent kit for screening early-stage cervical cancers based on cervical liquid-based cytology and DNA methylation
A kit and cytology technology, applied in the field of kits for early cervical cancer screening based on cervical liquid-based cytology and DNA methylation, can solve the heterogeneity of operation methods and experimental reagents, differences in genetic background, etc. problem, to achieve the effect of strong primer specificity, convenient specific amplification, and easy amplification conditions
Patent Information
- Authority / Receiving Office
- CN · China
- Current Assignee / Owner
- Publication Date
- 2015-12-23
Smart Images
Figure 1 Figure 2 Figure 3
Abstract
Description
technical field
[0001] The invention relates to a kit for screening early cervical cancer based on cervical liquid-based cytology and DNA methylation. Background technique
[0002] Cervical cancer is one of the common gynecological malignancies. There are about 528,000 new cases and 266,000 deaths in the world every year, and about 85% of them occur in developing countries. The incidence rate in China remains high at 7.5 / 100,000 and the death rate is 3.4 / 100,000. In some backward areas that lack reasonable screening, the incidence rate is even as high as 81 / 100,000. According to preliminary estimates, by 2030, there will be approximately 474,000 cervical cancer deaths per year, of which more than 95% may occur in backward and developing countries. Therefore, it is of great significance to find an effective method for early screening of cervical cancer, to screen out cervical precancerous lesions and cancer patients, and to implement effective early diagnosis and early trea...
Examples
Embodiment Construction
[0039] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.
[0040] 1. DNA extraction of cervical exfoliated cells:
[0041] The exfoliated cells of the cervix of the patient were taken and extracted with the QlA & DNA Mini Kit (Qiagen GmbH, Germany) kit, and the resulting DNA solution was 80 μL;
[0042] 2. Serum free DNA methylation modification:
[0043] Take 1 μg of extracted exfoliated cell DNA and modify it with QIAampEpiTectBis μL fiteKits (Qiagen GmbH, Germany) kit, and finally obtain 30 μL of modified DNA solution;
[0044] 3. Construction and optimization of real-time quantitative methylation-specific PCR (QMSP) reaction system:
[0045] 1). Real-time primer sequence:
[0046] Primer for JAM3-M4: MF:CGTAGTTAGGGTTGGGATTC (SEQ ID NO.6)
[0047] MR: GAAATCCGACGACTATCCGA (SEQ ID NO. 7),
[0048] Primer for β-actin: MF:TGGTGATGGAGGAGGTTTAGTAAGT (SEQ ID NO.16)
[0049] MR:AACCAATAAAACCTACTCCCTCCCTAA (SE...