Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Reagent kit for screening early-stage cervical cancers based on cervical liquid-based cytology and DNA methylation

A kit and cytology technology, applied in the field of kits for early cervical cancer screening based on cervical liquid-based cytology and DNA methylation, can solve the heterogeneity of operation methods and experimental reagents, differences in genetic background, etc. problem, to achieve the effect of strong primer specificity, convenient specific amplification, and easy amplification conditions

Active Publication Date: 2015-12-23
SHANDONG UNIV QILU HOSPITAL
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Researchers at home and abroad have made exciting progress in the early screening of cervical cancer by using tumor suppressor gene methylation detection. However, there are large differences between different studies of the same gene. The reasons may be as follows: 1. Specificity of gene methylation sites; 2. Differences in genetic background of genes; 3. Heterogeneity of operation methods and experimental reagents

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent kit for screening early-stage cervical cancers based on cervical liquid-based cytology and DNA methylation
  • Reagent kit for screening early-stage cervical cancers based on cervical liquid-based cytology and DNA methylation
  • Reagent kit for screening early-stage cervical cancers based on cervical liquid-based cytology and DNA methylation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0039] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0040] 1. DNA extraction of cervical exfoliated cells:

[0041] The exfoliated cells of the cervix of the patient were taken and extracted with the QlA & DNA Mini Kit (Qiagen GmbH, Germany) kit, and the resulting DNA solution was 80 μL;

[0042] 2. Serum free DNA methylation modification:

[0043] Take 1 μg of extracted exfoliated cell DNA and modify it with QIAampEpiTectBis μL fiteKits (Qiagen GmbH, Germany) kit, and finally obtain 30 μL of modified DNA solution;

[0044] 3. Construction and optimization of real-time quantitative methylation-specific PCR (QMSP) reaction system:

[0045] 1). Real-time primer sequence:

[0046] Primer for JAM3-M4: MF:CGTAGTTAGGGTTGGGATTC (SEQ ID NO.6)

[0047] MR: GAAATCCGACGACTATCCGA (SEQ ID NO. 7),

[0048] Primer for β-actin: MF:TGGTGATGGAGGAGGTTTAGTAAGT (SEQ ID NO.16)

[0049] MR:AACCAATAAAACCTACTCCCTCCCTAA (SE...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a reagent kit for screening early-stage cervical cancers based on cervical liquid-based cytology and DNA methylation. The reagent kit comprises orange-G6, brilliant green liquid, Bismarck brown liquid, eosin Y liquid, a QlAamp DNA Mini Kit reagent kit body, a QIAamp EpiTect Bisulfite Kits reagent kit body and PCR reaction liquid, the forward primer sequence of JAM3-M4 is shown as SEQ ID No.6, the reverse primer sequence of JAM3-M4 is shown as SEQ ID No.7, the forward primer sequence of beta-actin is shown as SEQ ID No.16, the reverse primer sequence of beta-actin is shown as SEQ ID No.17. According to the reagent kit for screening the early-stage cervical cancers, detection flexibility, specificity, the positive predictive value and the negative predictive value meet the requirements of clinical diagnosis through primary verification of clinical tissue samples and further verification of a large amount of cervical exfoliated cytology.

Description

technical field [0001] The invention relates to a kit for screening early cervical cancer based on cervical liquid-based cytology and DNA methylation. Background technique [0002] Cervical cancer is one of the common gynecological malignancies. There are about 528,000 new cases and 266,000 deaths in the world every year, and about 85% of them occur in developing countries. The incidence rate in China remains high at 7.5 / 100,000 and the death rate is 3.4 / 100,000. In some backward areas that lack reasonable screening, the incidence rate is even as high as 81 / 100,000. According to preliminary estimates, by 2030, there will be approximately 474,000 cervical cancer deaths per year, of which more than 95% may occur in backward and developing countries. Therefore, it is of great significance to find an effective method for early screening of cervical cancer, to screen out cervical precancerous lesions and cancer patients, and to implement effective early diagnosis and early trea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6886C12Q2600/154
Inventor 孔北华殷爱军贾琳司曼菲
Owner SHANDONG UNIV QILU HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products