Functional identification and application of a litchi leaf characteristic expression gene lcfkbp16-2 promoter
A technology of gene expression and fragmentation, applied in the fields of application, genetic engineering, angiosperms/flowering plants, etc., can solve problems such as changing plant metabolism
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1. Obtaining of the promoter sequence of the litchi leaf-specific expression gene Lc FKBP16-2
[0023] Pick the mature functional leaves and newly opened flowers that are free from diseases and insect pests in the middle of the fruiting mother branch, transport them back to the laboratory within 3 hours, wash them with sterile water, absorb excess water, freeze them quickly in liquid nitrogen, and store them in a -76°C ultra-low temperature refrigerator for later use. Pick eight ripe "Concubine Smile" fruits and transport them back to the laboratory within 3 hours, select healthy fruits without pests and diseases, rinse them with sterilized water several times, absorb excess water, peel off the peel, seeds and pulp, and freeze them in liquid nitrogen at -76°C Store in ultra-low temperature refrigerator for later use. The mature seeds of "Concubine Smile" cultivated healthy seedlings in the seedling plug. After 3 months, the roots were taken out, rinsed with ster...
example 2
[0026] Example 2. Investigation of expression pattern of litchi LcFKBP16-2 gene in different tissues
[0027] Since the expression of litchi actin (actin) gene is basically the same in various tissues of litchi, actin is generally used as an internal reference gene to detect the relative expression of litchi genes, and the following primers are used to amplify the cDNA of each tissue: Act_F: CAACTGGTATTGTCTTGGATTCTG ; Act_R: TCATCAAGGCATCGGTTAGA. The following primers were used to amplify the cDNA of LcFKBP16-2 gene: LcFKBP16-2_F:TTCAACCCAGCAATCGTCT; LcFKBP16-2_R:CGGAGCGAGCAAAAGTGA. The reaction system is as follows: 5μL 2×SYCR Premix Ex Taq TM II, 1 μL cDNA template, 0.4 μL forward primer (LcFKBP16-2_F, 10 μM) and 0.4 μL reverse primer (LcFKBP16-2_R, 10 μM), 0.2 μL 50×ROX Reference Dye II, 3 μL ddH 2 O. The reaction conditions were: pre-denaturation at 95°C for 30s; denaturation at 94°C for 5s; annealing at 60°C for 34s; cycle 40 times.
[0028] The results of quantitati...
example 3
[0029] Example 3. Construction of plant LcFKBP16-2 gene promoter expression vector
[0030]The plant expression vector pCAMBIA1304 plasmid was extracted, the CaMV35S promoter was excised with restriction endonucleases Pst I and Spe I, and the large fragment was recovered by cutting the gel. The correctly sequenced LcFKBP16-2 gene promoter cloning vector was digested with PstI and EcoR I, and the LcTLP (sweet-like protein) gene cloning vector was digested with EcoR I and Spe I, and the gel was recovered to obtain the LcFKBP16-2 gene promoter respectively. Subfragments and LcTLP gene fragments. Then T4 ligase was used to connect the LcFKBP16-2 gene promoter, the LcTLP gene and the pCAMBIA1304 basic expression vector without the CaMV35S promoter. The specific connection system (25 μL) is: 10×T4 DNA Ligase Buffer 2.5 μL, LcFKBP16-2 gene promoter DNA fragment (85ng / μL) 3.6 μL, LcTLP gene DNA fragment (58.1ng / μL) 1.17 μL, CaMV35S promoter removed pCAMBIA1304 plasmid vector (98.5ng...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More