Application of Insect DNA Methyltransferase dnmt1 in Pest Control

A methyltransferase, insect technology, applied in recombinant DNA technology, DNA/RNA fragments, applications, etc., can solve problems such as low binding efficiency and low binding efficiency, and achieve the effects of increased larval mortality, reduced feeding, and increased mortality

Active Publication Date: 2019-12-24
SOUTH CHINA NORMAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Mitsudome et al. found that silkworm BmDNMT can not only combine with hemimethylated DNA to maintain methylation, but also combine with unmethylated DNA to achieve de novo methylation. Binding efficiency of methylated DNA is lower than that of hemimethylated DNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Insect DNA Methyltransferase dnmt1 in Pest Control
  • Application of Insect DNA Methyltransferase dnmt1 in Pest Control
  • Application of Insect DNA Methyltransferase dnmt1 in Pest Control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 BmDnmt1 The phenotype of the silkworm whose expression was suppressed

[0027] 1) silkworm Dnmt1 dsRNA vector construction

[0028] Bombyx mori were synthesized according to the instructions of the kit T7 RiboMAX™ Express RNAi System (purchased from Promega) Dnmt1 The dsRNA sequence (SEQ ID NO: 1), GFP The dsRNA sequences (SEQ ID NO: 2) were used to construct the silkworm Dnmt1 The dsRNA carrier and the blank control carrier are used for subsequent RNAi interference experiments.

[0029] The silkworm mentioned above Dnmt1 dsRNA sequence (SEQ ID NO: 1):

[0030] 5’-AUCAAGCUGGAGUUGCAGAAUGCAAGUGGGCUAUUGAAAACGUGGAAGCUGCUUCUCAUGCUUAUUCAUUAAAUAAUAAAAGUUGUAUUGUAUUUAAUGAAGACUGUAAUGCACUUUUGAAAACUGUAAUGUCUGGUGCUAAGCACAGCGCGAAUGGACUGCGGCUCCCCAUGCAAGGAGAAGUGGAGCUUUUAUGUGGCGGGCCACCAUGUCAAGGCUUCUCCGGAAUGAAUCGUUUUAAUUCAAGAGAGUAUUCAAACUUCAAAAACUCAUUAGUUGCAUCGUAUUUAUCGUUUUGUGAUUAUUACAGACCUAAAUAUUUUAUACUGGAAAACGUUCGUAACUUUGUGGCCUUUAA-3’(SEQ IDNO:1)。

[0031] GFP...

Embodiment 2

[0045] Example 2 Dnmt1 Phenotypes of Spodoptera litura with suppressed expression

[0046] 1) Spodoptera litura Dnmt1 sequence acquisition

[0047] From our unpublished database of expression in the midgut of Spodoptera litura feeding on mustard greens, Spodoptera litura Dnmt1 The cDNA sequence was obtained by PCR and verified by sequencing. Spodoptera litura Dnmt1 The ORF sequence is (SEQID NO: 3):

[0048]5’-ATGGATGAATATATAGAAACTAAACACCTACTAGATATTGAAATGGATGAATATATAGAAACTAAACACCAACTAGATATTAAAATGGATGAAAATGAAAACAATAATGTTATAGCGAAAACAAAACCAATTGTTCTTGACAATGAGAAATGTGAAACCTGTGGCCAATTTCTCAATAATTCAGATATAATTTTCTATCAAGGACACCCACAGAATTCAGTGGAAGAGTATATAGCATTGACTAATGAGAAACTTGTTCTAGCATCAGGTGAAGAGGGTGATATAATGGAAAGACCACAAACCAATATAACCAGTTTCTGTATATTTGACGAGCAAGGCCACCTGGTACCAATTGATGGTGGTCTTGTTGAAAACGATGTGTGTATTTATATGTCAGGATACTTGAAGTCAATATGCACAGATTCACCGGAAATTGATGATGAATCGGTCCCTGTGAAAGATGTAGGCCCTATTATTGAATGGTTCATACATGGCTTTGACGGTGGTGAGAAAAACTGTATCACATTATCAACAGAATTTGGAGAATATAATTTATTGAAACCAAGTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an application of an insect DNA transmethylase Dnmt1 to the pest control. The research on Dnmt1 of spodoptera litura and domesticated silkworm by adopting transient RNAi discovers that the Dnmt1 regulates and controls growth and development of lepidoptera insects, the Dnmt1 expression is inhibited, and the insects have symptoms of maldevelopment, slow growth, death and the like. Based on this, it is proposed for the first time that an inhibitor for inhibiting the Dnmt1 expression can be used in pesticides. It is discovered for the first time that after the Dnmt1 is disturbed, insect bodies are remarkably reduced in size, the larval mortality is increased, but larvae are not all killed immediately. It is showed that after the Dnmt1 is disturbed, the insect bodies grow slowly and abnormally, food intake is reduced, the control on pest growth and quantity can be realized, and the purpose of effectively controlling pests is achieved on the premise of not influencing ecological balance.

Description

technical field [0001] The invention relates to the application of insect DNA methyltransferase Dnmt1 in the control of lepidopteran pests. Dnmt1 regulates the growth of insect larvae, so the research and development of transgenes or inhibitors around insect Dnmt1 can achieve the purpose of pest control. Background technique [0002] As an important epigenetic modification ubiquitous in eukaryotes, DNA methylation plays an important role in the regulation of biological growth and development. In recent years, with the continuous improvement and innovation of DNA methylation research methods, especially the rapid development of large-scale sequencing technology, it has become possible to measure and analyze the methylation profile from the whole genome level, and the research on methylation of insects has made great progress. Some progress and results have been achieved. The reported functions are mainly related to the regulation of embryonic development, gene imprinting, w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82A01N57/16A01P7/04
CPCA01N57/16C12N15/1137C12N15/8286C12N2310/14
Inventor 郑思春徐关峰张捷
Owner SOUTH CHINA NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap