Unlock instant, AI-driven research and patent intelligence for your innovation.

Rotavirus-encoded small RNA molecule regulating self proliferation

A technology of rotavirus, RV-VSRNA1755, applied in the field of biomedicine

Inactive Publication Date: 2017-05-31
INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report on whether rotavirus encodes miRNAs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rotavirus-encoded small RNA molecule regulating self proliferation
  • Rotavirus-encoded small RNA molecule regulating self proliferation
  • Rotavirus-encoded small RNA molecule regulating self proliferation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1. Small RNA sequencing analysis during rotavirus infection

[0023] The isolated wild-type rotavirus ZTR-68 (preservation unit: General Microbiology Center of China Committee for Culture Collection of Microorganisms; deposit number: CGMCC No.5265) was infected with sensitive cells MA104 cells and then analyzed by small RNA deep sequencing. The expression profile of microRNAs during virus infection was studied, and it was found that the expression levels of 40 microRNAs changed after rotavirus infection. After comparison with multiple databases (miRBase database, Rfam database, GeneBank database, etc.) and RT-PCR verification, it was found that four of the 40 differentially expressed microRNAs were new small RNA molecules with unknown functions. Among them, the miRNA molecule with the largest expression difference level is RV-VSRNA1755, and the structure and sequence of the precursor neck loop have been predicted ( figure 1 ), but its role and function in the p...

Embodiment 2

[0025] Example 2. Detection of expression level of RV-VSRNA1755 molecule after infection of different host cells by different strains (wild strains and laboratory strains) and its time-sensitive expression

[0026]After infecting MA104 cells, HT-29 cells and Caco2 cells with the isolated wild strain ZTR-68 strain and the laboratory strain Wa strain, respectively, the expression of RV-VSRNA1755 was detected, and the small molecule was up-regulated at different levels ( image 3 , Figure 4 ). Compared with other host cells, the wild strain and laboratory strain had the highest expression level after infecting MA104 cells ( image 3 , Figure 4 ). We also detected the up-regulated expression of RV-VSRNA1755 to varying degrees after infection of MA104 cells with five G-type rotavirus strains preserved in the laboratory, indicating that the production of RV-VSRNA1755 molecules is not only for G1 type, but also for other genotypes. This regulatory molecule is also present in vi...

Embodiment 3

[0027] Example 3, Research on the role of RV-VSRNA1755 molecule in rotavirus proliferation

[0028] Inhibitors and mimics targeting RV-VSRNA1755 molecules were synthesized, respectively transfected into host cells (MA104 cells), and infected with rotavirus 24 hours after transfection. After qRT-PCR experiment verification, compared with the control MA104 cells, the expression level of RV-VSRNA1755 was significantly up-regulated and down-regulated ( Figure 7 ). Intracellular viral RNA was extracted 16 hours after RV infection, and the transcription of rotavirus genome NSP3 and VP7 was detected by real-time PCR. The results of NSP3 showed that the copy number of NSP3 in the down-regulated 1755 group increased faster than that in the up-regulated 1755 group at the same time point, and the up-regulated 1755 group inhibited the virus proliferation ( Figure 8 A). The results of VP7 showed that compared with the control infection group, when the RV-VSRNA1755 molecule was up-regu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biological medicines, and in particular to a rotavirus-encoded small RNA molecule regulating self proliferation. The invention discloses the rotavirus-encoded small RNA molecule regulating self proliferation, wherein the molecule is named RV-vsRNA1775. The small RNA molecule is characterized in that the nucleotide sequence of the small RNA molecule is 5'ATTCAGGATCCTGGAATGGCG3'; the sequence of the RV-VSRNA1775 molecule is located in a 114aa-115aa region of an NSP4 gene, that is, a coiled-coil region. By researching the rotavirus-encoded small RNA, the mutual regulating relationship between the rotavirus and a host cell is further understood, thereby providing a possible path for finding specific drugs for rotavirus injection and providing a theoretical ground for screening drugs taking RV-VSRNA1755 molecule as a rotavirus therapeutic target in the future.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a small RNA molecule encoded by the virus itself. Background technique [0002] Rotavirus belongs to the Reovirus genus and is a non-enveloped, icosahedral-shaped virus. The genome is discontinuous and consists of 11 segments of double-stranded RNA, encoding 6 structural proteins (VP1-4, 6, 7) and 6 non-structural proteins (NSP1-6). NSP4, a nonstructural protein of rotavirus with a size of 175aa, is an endoplasmic reticulum transmembrane glycoprotein with multiple functions, which was first discovered as an enterotoxin. The structural research is relatively clear, consisting of three hydrophobic regions (H1-H3) and two mannose glycosylation sites. Among them, the functions of multiple amino acid sites in H1 (8-18aa), H3 (55-69aa and 47-92aa), coiled-coil domain and flexible region have been studied, H2 region function is unknown. NSP4 plays an important regulatory role in the repli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113
CPCC12N15/1131C12N2310/141
Inventor 周艳耿盼盼李鸿钧吴晋元刘雅玲解裕萍尹娜易山孙茂盛
Owner INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI