Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

69 results about "Host cell filopodium" patented technology

Thin, stiff protrusion extended by the leading edge of a motile host cell such as a crawling fibroblast or amoeba, or an axonal growth cone; usually approximately 0.1 um wide, 5-10 um long, can be up to 50 um long in axon growth cones; contains a loose bundle of about 20 actin filaments oriented with their plus ends pointing outward. [GOC:jl]

Methods of in vivo engineering of large sequences using multiple crispr/cas selections of recombineering events

The present invention provides a method for making a large nucleic acid having a defined sequence in vivo. The method combines recombineering techniques with a CRISPR / Cas system to permit multiple insertions of defined sequences into a target nucleic acid at one time, double stranded cleavage of target nucleic acids in which the defined sequences were not successfully inserted, and selection of successful recombinant cells. The method further includes repeating the process one or more times, using a successful recombinant from one round as the host cell for the next round.
Owner:AGILENT TECH INC

Host Cells with Artificial Endosymbionts

The present invention is directed generally to eukaryotic cells comprising single-celled organisms that are introduced into the eukaryotic cell through human intervention and which transfer to daughter cells of the eukaryotic cell through at least five cell divisions, and methods of introducing such single-celled organisms into eukaryotic cells. The invention also provides methods of using such eukaryotic cells. The invention further provides single-celled organisms that introduce a phenotype to eukaryotic cells that is maintained in daughter cells. The invention additionally provides eukaryotic cells containing magnetotactic bacteria.
Owner:BELL BIOSYST

High metastatic potential hepatoma cell line capable of steady autophagy indication, and establishment method and application method thereof

InactiveCN102115730AHigh metastatic potentialDynamic observation of autophagy changesMicrobiological testing/measurementMicroorganism based processesMorphological filterIn vivo
The invention belongs to the field of biomedical science, and aims to provide a high metastatic potential hepatoma cell line capable of steady autophagy indication, and an establishment method and an application method thereof. Lentivirus expression vectors containing EGFP (enhanced green fluorescent protein)-LC3 (light chain 3) autophagy reporter genes are constructed and used to infect hepatoma cells with high metastatic potential, so that host cells can express the EGFP-LC3 steadily and efficiently and indicate autophagy changes of the hepatoma cells steadily. To apply the cell line, metastasis research models can be established in vitro and in vivo for the observation on autophagy changes during metastasis, and the cell autophagy changes can be analyzed rapidly and quantitatively by adopting an image analysis method based on Top-hat operators and morphological filter. The high metastatic potential hepatoma cell line has the characteristics that autophagy indication is conducted steadily, reliably and sensitively in a real-time manner, the metastasis occurs definitely, the autophagy is quantified rapidly and accurately, the operation is simple and convenient, and the like, and can greatly facilitate correlation study on autophagy and metastasis.
Owner:ZHONGSHAN HOSPITAL FUDAN UNIV

Recombinant lentiviral expression vector, reconstitution cell and application of reconstitution cell to culturing natural killer cell

PendingCN109371062AHigh expressionProlong proliferation timeGenetically modified cellsBlood/immune system cellsSequence signalMica gene
The invention provides a recombinant lentiviral expression vector, and belongs to the technical field of cell engineering. The recombinant lentiviral expression vector comprises a 21mb gene, a 41BBL gene and an MICA gene which are sequentially connected in series; and the 21mb gene is obtained by sequentially connecting a signal peptide gene, an IL21 gene, a CD8 Hinge gene and a CD8 transmembranegene in series. After the provided recombinant lentiviral expression vector transfects a host cell, the host cell expresses the MICA and the 41BBL, and the IL21 is fused and expressed (but not secreted in a culture environment) on a cytomembrane of the host cell. After the provided recombinant lentiviral expression vector transfects the host cell, an obtained reconstitution cell promotes the highexpression of the NKG2D, avoids excessive activation of an NK cell and prolongs the proliferation time of the NK cell in the process of induction culture of the NK cell.
Owner:BEIJING DCTY BIOTECH CO LTD

Cell culture medium

ActiveUS20120156782A1Fast and economically efficient scale-upFacilitate scientificConnective tissue peptidesGenetically modified cellsSingle cell suspensionCell culture media
The present disclosure related to isolated laminin-521, methods for making recombinant laminin-521, host cells that express recombinant laminin-521, and compositions containing laminin-521. Laminin-521 can maintain stem cells in vitro pluripotency, enable self-renewal, and enable single cell survival of human embryonic stem cells. When pluripotent human embryonic stem cells are cultured on plates coated with recombinant laminin-521 (laminin-11), in the absence of differentiation inhibitors or feeder cells, the embryonic stem cells proliferate and maintain their pluripotency. It has also been discovered that human recombinant laminin-521 (laminin-11) provides single cell survival of stem cells after complete dissociation into a single cell suspension. Useful cell culture mediums containing at most 3.9 ng / ml of beta fibroblast growth factor (bFGF) are also described herein.
Owner:BIOLAMINA

Host cells and methods of use

The present invention provides genetically modified Pichia strains wherein at least one nucleic acid sequence encoding a functional gene product and / or at least one nucleic acid sequence necessary for expression of at least one functional gene product in said Pichia strain is genetically modified, wherein said gene product is responsible for proteolysis and / or glycosylation in said genetically modified Pichia strain. In particular, Pichia strains are provided wherein nucleic acid sequence encoding a functional gene product or expression of said gene product are genetically modified: PEP4, PRB1, YPS1, YPS2, YMP1, YMP2, YMP3 and PMT4. Also provided herein are genetically modified host cells wherein wild type parent of said genetically modified host cell comprises a gene encoding a polypeptide having at least 60% sequence identity to amino acids 1-865 of SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8 wherein said gene is genetically modified in the genome of said host cell such that the gene product is reduced or eliminated in said genetically modified host cell compared with said wild type host cell.
Owner:GLAXO SMITHKLINE LLC

Double-tagging microbial cell biosensor for detecting N-acyl homoserine lactone

The invention relates to a double-tagging microbial cell biosensor for detecting N-acyl homoserine lactone (AHL), and the biosensor is suitable for detection of AHL and characterization of host cells in the environment. The cell biosensor comprises: Escherichia coli used as host cells for carrying recombinant plasmids; recombinant plasmid containing an ahlI promoter responding to AHL, a cherry red fluorescent protein reporter gene mCherry and an AHL regulatory protein gene ahlR; and a neomycin phosphotransferase promoter gene nptII for characterization of host bacteria, a green fluorescent protein reporter gene gfp and a T1-4 pUC19 plasmid of four terminator rrnb tandem sequence. According to the biosensor, constitutive type of expression green fluorescent protein is used to characterize the host bacteria; the response time to AHL is 6 h; and the minimum detectable concentration of AHL is 50 nmol / L. The biosensor has the advantages of high sensitivity, fast response, low cost and simple operation, and can be widely applied to detection of AHL and host characterization in the environment.
Owner:RES CENT FOR ECO ENVIRONMENTAL SCI THE CHINESE ACAD OF SCI

Increasing productivity of e. coli host cells that functionally express p450 enzymes

The present invention relates to the production of chemical species in bacterial host cells. Particularly, the present invention provides for the production of chemical species in Escherichia coli (E. coli) host cells that functionally express engineered P450 enzymes.
Owner:MANUS BIO INC

Cell broth clarification and host cell protein removal

The present invention relates to a method for clarification of, and removal of host cell proteins from, a cell broth consisting essentially of viable cells, a culture medium and a secreted desired biological substance having an overall positive charge in the cell broth by contacting the cell broth with a particulate anion exchanger, allowing an adequate incubation time to result in formation of a cell pellet and a supernatant layer, separating the resulting cell pellet from the supernatant layer. The present invention further relates to a method for the recovery of a secreted desired biological substance from the cell broth by extracting the secreted desired biological substance from the supernatant layer.
Owner:PERCIVIA LLC

Application of vector containing CYP704B2 gene

Application of a CYP704B2 gene and a coding protein thereof belongs to the technical field of gene engineering. The invention relates to a gene which codes the following protein (a) or (b): (a) a protein consisting of an amino acid sequence shown as SEQ ID NO:2; (b) a protein derived from (a) by substitution, deletion or adding one or a plurality of amino acids on the amino acid sequence of (a), and with aliphatic acid hydroxylase activity. The invention also relates to a plasmid, comprising a gene shown as SEQ ID NO:1. The invention also relates to a host cell, comprising a gene shown as SEQ ID NO:1. The invention also relates to a polypeptide, an amino acid sequence of which is shown as SEQ ID NO:2. The CYP704B2 gene of the invention is an anther specific expressed gene, which can regulate paddy rice anther epidermal layer and pollen extine cutin monomer component synthesis, and deletion of which can specifically lead to paddy rice male sterility.
Owner:SHANGHAI JIAO TONG UNIV

Tdp-43-storing cell model

Disclosed is a transformed cell (a cell model) which can form a cytoplasmic inclusion body derived from TAR DNA-binding protein of 43 kDa (TDP-43) that is found in the brain of a patient suffering from a neurodegenerative disease such as FTLD and ALS. The transformed cell is characterized by having, introduced therein, a promoter capable of functioning in a host cell and a mutant TDP-43 gene.
Owner:TOKYO METROPOLITAN INST OF MEDICAL SCI

Human auxin fusion protein TAT-hGH as well as preparation method and application thereof

The invention discloses fusion protein TAT-hGH of human auxin and cell-penetrating peptide TAT as well as a preparation method and application of the fusion protein TAT-hGH. A deoxyribonucleic acid (DNA) sequence of the fusion protein TAT-hGH, a carrier containing the DNA sequence and a host cell containing the carrier are encoded; and a method for preparing the fusion protein TAT-hGH by gene engineering is provided. The fusion protein TAT-hGH has the functions of promoting Jurkat cell proliferation activity and influencing a transcriptional level of insulin-like growth factor (IGF) I of downstream factors; and meanwhile, the fusion protein TAT-hGH has a function of penetrating through intestines. The fusion protein TAT-hGH can be orally taken, enters blood by penetrating through an intestinal cell membrane, and can reach different tissues by blood circulation, so that the utilization ratio of hGH is increased, and the medicinal effect is also improved. The preparation method can be applied to large-scale industrial production, and is high in expression amount, easy to operate and low in cost.
Owner:WUHAN UNIV

Expression Cassette, Recombinant Host Cell and Process for Producing a Target Protein

InactiveUS20120107875A1BacteriaHydrolasesProtein targetIntein
Disclosed herein is a process for producing a target protein, in which a recombinant polynucleotide is constructed to encode a fusion protein including: (i) an anchoring protein that includes a N-terminal amino acid sequence of an ice nucleation protein, so that the fusion protein, once expressed in the host cell, is directed by the anchoring protein to be anchored and exposed on the outer membrane of the host cell; (ii) the target protein; and (iii) a self-splicing protein that includes a first end fused with the anchoring protein and a second end fused with the target protein, wherein the self-splicing protein includes a N-terminal or C-terminal amino acid sequence of an intein protein at the second end thereof, such that upon an environmental stimulus, the self-splicing protein exerts a self-cleavage at the second end thereof to release the target protein from the fusion protein.
Owner:NATIONAL CHUNG HSING UNIVERSITY

Ngago-based gene-editing method and the uses thereof

PendingUS20190284547A1Reduced random DNA cleaving abilityMore flexibleHydrolasesNucleic acid vectorPhosphorylationMutant
This invention relates to a method to produce gene alterations in the genomes of a eukaryotic and prokaryotic host cell. The method comprises utilizing Argonaute from Natronobacterium gregoryi (NgAgo) or a mutant thereof, and complementary 5′ phosphorylated single-stranded DNA that target the enzyme to cleave specific regions of the chromosome. Additionally, N-terminal truncations (deletion of the repA domain; N-del), or its mutants including N-del / E598A, N-del / D601P, and N-del / E602P reduces random cleavage and can be used for targeted gene editing with a guide DNA. An expression system or a host cell and method of creating thereof are also in the scope of this application.
Owner:PURDUE RES FOUND INC

Method for detecting integration site of HPV in host genome

ActiveCN110527714AMicrobiological testing/measurementHuman papillomavirusHost genome
The invention discloses a method for detecting an integration site of HPV (human papillomavirus) in a host genome. The method comprises the following steps: extracting host genome DNA from a biological sample from a subject, and breaking the host genome DNA to fragments with a main peak of 800bp-4kb; performing a first detection on the obtained fragments by using a probe set to obtain a target sequence; preprocessing the target sequence to improve detection sensitivity; and performing a second detection on the target sequence without PCR amplification based on an electric signal sequencing technology so as to confirm the integration site of the HPV in the host genome. The method can quickly and timely analyze the state of the HPV virus existing in host cells, has obvious clinical application advantages, and can more effectively judge the integration information of the HPV without error correction analysis.
Owner:GENEIS TECH BEIJING CO LTD

Method for agrobacterium-mediated transformation of plants

The invention provides methods and compositions for enhancing the efficiency of Agrobacterium-mediated transformation of host cells such as plant cells. Plant expression constructs comprising a gene encoding a VIP2 or VIP2-like polypeptide are provided, as well as methods for utilizing such constructs to enhance Agrobacterium-mediated transformation efficiency.
Owner:SAMUEL ROBERTS NOBLE FOUND

Methods for selecting eukaryotic cells expressing a heterologous protein

The invention pertains to a method for selecting at least one eukaryotic host cell expressing a product of interest, comprising(a) providing a plurality of eukaryotic host cells, wherein cellular viability of said host cells is dependent upon folate uptake, wherein said host cells comprise at least(i) a foreign polynucleotide encoding a product of interest and(ii) a foreign polynucleotide encoding a DHFR enzyme;(b) culturing said plurality of eukaryotic host cells in a selective culture medium comprising at least an inhibitor of DHFR and folate in a limiting concentration; and(c) selecting at least one eukaryotic host cell expressing the product of interest.Also provided is a method for expressing a product of interest which is based on host cells selected by said method and a cell culture medium.
Owner:NOVARTIS AG

TROP2 chimeric antigen receptor, T cell, and preparing method and application of thereof

The invention provides an anti-trophoblast cell-surface antigen-2 chimeric antigen receptor, a T cell, preparing method and application thereof. The anti-trophoblast cell-surface antigen-2 chimeric antigen receptor comprises an anti-trophoblast cell-surface antigen-2 scFv antibody, an IgG4 hinge region, a CD28 transmembrane region, a CD3 intracellular region and a 41BB intracellular region. The invention further provides nucleic acid coding the receptor, a carrier comprising the nucleic acid, and a host cell comprising the carrier. The invention further provides a method for utilizing the carrier for transducing the human CD8+ / CD4+T cell to obtain a CARTROP2-T cell. The cell is obtained through gene modification and transformation on the T cell. The receptor can be used for treating diseases related to expression of the trophoblast cell-surface antigen-2, and particularly used for specifically recognizing and killing tumors for expressing the trophoblast cell-surface antigen-2.
Owner:盈凯赛威(北京)生物科技有限公司

Host cells and methods of use

The present invention relates to genetically modified host cells, in particular yeast cells, comprising at least one isolated polynucleotide encoding a Killer Expression protease (Kex2p) or a fragment and / or variant thereof which has at least one Kex2p functional activity and at least one isolated polynucleotide encoding a Protein Disulfide-Isomerase (Pdi1) or a fragment and / or variant thereof which has at least one Pdi functional activity. Also provided herein are genetically modified host cells comprising at least one isolated polynucleotide encoding a Killer Expression protease (Kex2p) or a fragment and / or variant thereof which has at least one Kex2p functional activity, at least one isolated polynucleotide encoding a Protein Disulfide-Isomerase (Pdi1) or a fragment and / or variant thereof which has at least one Pdi1 functional activity and at least one isolated polynucleotide encoding a Endoplasmic Reticulum Oxidoreductin (Ero1) or a fragment and / or variant thereof which has at least one Ero1 functional activity.
Owner:GLAXO SMITHKLINE LLC

Method for improving cell transfection efficiency through utilization of bacterial artificial chromosome homologous recombination

InactiveCN103352050AGood reorganization effectImprove the efficiency of transfecting integrated cellsVector-based foreign material introductionNucleofectionHost cell filopodium
The invention provides a method for improving cell transfection efficiency through utilization of bacterial artificial chromosome homologous recombination. Homologous recombination of BAC containing target genes is carried out through use of pABRG recombinant plasmid, then through use of nucleofection technology, the recombined BAC transfects host cells, through adoption Tol2 transposon optimized by mammal codons, so that the recombined BAC containing the target genes is integrated in to host cell genomes. Through successful construction of eGFP marker gene containg human UBC promoter and BAC carrier of eukaryotic screening resistant neo gene, wherein both ends of the carrier being provided with Loxp components, preparation for marking and resistibility removing after cell transfection are ready. In addition, transfection efficiency of electrotransfection BAC-Tol2-eGFP carrier can reach 1%-6%, the highest transfection efficiency can reach 10%, and a complete set of experimental routes and methods for use and operation of large mammalian BAC are provided.
Owner:HENAN UNIVERSITY

Rotavirus-encoded small RNA molecule regulating self proliferation

InactiveCN106754922ARegulation of proliferation rateDNA/RNA fragmentationRotavirus RNANucleotide
The invention relates to the field of biological medicines, and in particular to a rotavirus-encoded small RNA molecule regulating self proliferation. The invention discloses the rotavirus-encoded small RNA molecule regulating self proliferation, wherein the molecule is named RV-vsRNA1775. The small RNA molecule is characterized in that the nucleotide sequence of the small RNA molecule is 5'ATTCAGGATCCTGGAATGGCG3'; the sequence of the RV-VSRNA1775 molecule is located in a 114aa-115aa region of an NSP4 gene, that is, a coiled-coil region. By researching the rotavirus-encoded small RNA, the mutual regulating relationship between the rotavirus and a host cell is further understood, thereby providing a possible path for finding specific drugs for rotavirus injection and providing a theoretical ground for screening drugs taking RV-VSRNA1755 molecule as a rotavirus therapeutic target in the future.
Owner:INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI

Recombinant adenovirus and application thereof

The invention discloses a recombinant adenovirus and application thereof. The recombinant adenovirus is obtained by transferring an encoding gene of an interleukin 17 receptor D extracellular region Fc fusion protein to a host cell, wherein the amino acid sequence of the interleukin 17 receptor D extracellular region Fc fusion protein is a sequence 2 in a sequence table; and through a recombinant vector, the interleukin 17 receptor D extracellular region Fc fusion protein is transferred to the host cell. The experiment in the invention proves that a CIA (collagen in-duced arthritis) mice model is constructed by using an adenovirus vector of constructed and purified Ad / Hil-17RD-ECD-Fc, the prevention and treatment on the CIA mice are achieved by using the Ad / Hil-17RD-ECD-Fc, and finally, the alleviation degrees of CIA mice arthritis and bone injury are estimated and analyzed through He dyeing. Thus, a novel and effective method is provided for treating rheumatoid arthritis.
Owner:TSINGHUA UNIV

Methods of host cell modification

Described herein are novel methods of inserting nucleic acid sequences into host cells. Also described herein are genetically stable host cells comprising inserted nucleic acid sequences and methods of using such host cells in the generation of proteins.
Owner:GLAXOSMITHKLINE BIOLOGICALS SA

Method of Manufacturing Induced Pluripotent Stem Cell Originated from Somatic Cell

Disclosed is a method for manufacturing stem cells including preparing Oct-4 gene, Sox2 gene, C-myc gene, and Klf-4 gene from mouse embryonic stem cells, and allowing each of the genes to be infected in host cells using a lentiviral vector system to generate viruses in which each of the genes are induced; concentrating or mixing each of the viruses to prepare a virus concentrated mixture, and mixing the virus concentrated mixture and a first culture solution to prepare a virus solution; floating mouse somatic cells having been cultivated in advance in a first culture dish, and mixing and reacting the floated somatic cells and the virus solution to prepare a somatic cell-virus mixture; adding and retaining the somatic cell-virus mixture as is in a second culture dish including a second culture solution to induce the genes in the somatic cells; and cultivating the somatic cells.
Owner:MIRAE BIOTECH CO LTD

Preparation method and application of human prostate apoptosis response protein 4 and apoptin 2 ligand fusion protein

The invention provides a human prostate apoptosis response 4(Par4) protein or a selective for apoptosis induction cancer cells domain (SAC) and apoptin 2 ligand (Apo2L) fused protein, namely Par4-Apo2L or SAC-Apo2L fused protein, a DNA (Deoxyribonucleic Acid) sequence for coding the protein, a vector containing the DNA sequence for coding, a host cell containing the vector, a method for preparing the protein by using the gene engineering, and a medicinal composition containing the protein. The Par4 or the SAC and the Apo2L have an effect of selectively inducing the apoptosis of cancer cells, so the fused protein can be used for preparing medicaments for treating diseases such as cancers.
Owner:SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY

Bacterial mediated delivery of nuclear protein into pluripotent and differentiated cells

ActiveUS8617888B2Efficient systemEfficient introductionSugar derivativesBacteriaDirected differentiationType three secretion system
A modified P. aeruginosa type III secretion system has been developed that efficiently delivers selected proteins into a host cell. In one example, a functional nuclear Cre Recombinase is injected into embryonic stem (ES) cells and can be used to induce pluripotent stem (iPS) cells. This method of in vitro lineage directed differentiation prevents insertional mutagenesis and provides a route to selected stem cell renewal and cell-based therapies.
Owner:UNIV OF FLORIDA RES FOUNDATION INC

Method for amplifying and activating CIK lymphocyte

ActiveCN105695404AHelp activate recognition and killActivate identify and killMammal material medical ingredientsBlood/immune system cellsDiseaseDiabetes mellitus
The invention discloses a method for amplifying and activating CIK lymphocyte by using a host cell transfected with functional protein in combination with multiple kinds of protein. The method has the advantages that compared with the prior art, CIK lymphocyte amplified and activated through the method has higher purity, higher amplifying efficiency and higher capability of killing tumor and TAMs in a tumor microenvironment. The method has broad prospects in the aspect of controlling and relieving the progression of part of diseases such as cancer, infectious diseases and diabetes mellitus or the aspects of organ transplantation and hepatitis B.
Owner:ZHEJIANG UNIV

Rape transcription factor BnWRKY184, cloning method, carrier, host cell and application

ActiveCN110592101AHas a negative regulatory effectInhibit synthesisBacteriaMicrobiological testing/measurementCelluloseNucleotide
The invention belongs to the technical field of plant molecular biology, and particularly relates to a rape transcription factor BnWRKY184, a cloning method, a carrier, a host cell and an applicationto preparation of lignin-related transgenic plants. The nucleotide sequence of the rape transcription factor BnWRKY184 is represented as SEQ ID NO.1, the amino acid sequence is represented as SEQ ID NO.2, the length of the nucleotide sequence is 645 bp, and the length of the amino acid sequence is 215 amino acids. The provided rape transcription factor BnWRKY184 has a negative control effect, andcan directly overexpress to inhibit expression of plant lignin and cellulose synthetic genes, so that biosynthesis of lignin and cellulose is blocked, development of sclerenchyma is inhibited, the degree of lignification is reduced, and theoretical basis and related genes are provided for follow-up modification of lignin and cellulose content of rape and seed breeding of rape for vegetables, rapefor feed and rape for green manure.
Owner:HENAN UNIVERSITY

ACVR1-Fc fusion protein, and preparation method and application thereof

The invention relates to a ACVR1-Fc fusion protein, and a preparation method and application thereof. Specifically, the invention relates to the fusion protein ACVR1-Fc containing an ACVR1 element and an Fc element, a DNA sequence coding the fusion protein, a vector containing the coding sequence, a host cell containing the vector, a preparation method for the fusion protein, and application of the above-mentioned substances in prevention and / or treatment of diseases or symptoms (such as diseases, cancers and the like related to pleonosteosis) related to ACVR1 abnormity (e.g., ACVR1 mutation and / or overactivity). The fusion protein provided by the invention has stable expression, high yield and high activity (e.g., effective inhibition of ossification and cartilage differentiation) and is simple to purify, so the fusion protein can be effectively used for prevention and treatment of diseases or symptoms related to ACVR1 abnormity.
Owner:SHANGHAI KANDA BIOTECHNOLOGY CO LTD