TROP2 chimeric antigen receptor, T cell, and preparing method and application of thereof
A technology of chimeric antigen receptors and cells, which is applied in the field of tumor treatment, can solve the problems of restricting the effective activation of specific T cells, and achieve the effects of high secretion level, killing ability, good vitality, and large number of cell proliferation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0080] Example 1. Construction of trophoblast cell surface antigen 2 recombinant protein expression plasmid
[0081] The cDNA fragment of trophoblast surface antigen 2 was synthesized in vitro, and the HIS tag was added to the end, and the restriction sites EcoR1 and BglII were introduced into the two ends respectively, and cloned into the expression vector pCAGGS to construct the recombinant eukaryotic expression plasmid of the full-length protein of trophoblast surface antigen 2 . The above work was completed by Suzhou Synbio.
[0082] The cDNA sequence of the trophoblast surface antigen 2 recombinant protein is as follows:
[0083] ATGGCTCGGGGCCCCGGCCTCGCGCCGCCACCGCTGCGGCTGCCGCTGCTGCTGCTGGTGCTGGCGGCGGTGACCGGCCACACGGCCGCGCAGGACAACTGCACGTGTCCCACCAACAAGATGACCGTGTGCAGCCCCGACGGCCCCGGCGGCCGCTGCCAGTGCCGCGCGCTGGGCTCGGGCATGGCGGTCGACTGCTCCACGCTGACCTCCAAGTGTCTGCTGCTCAAGGCGCGCATGAGCGCCCCCAAGAACGCCCGCACGCTGGTGCGGCCGAGTGAGCACGCGCTCGTGGACAACGATGGCCTCTACGACCCCGACTGCGACCCCGAGGGCCGCTTCAAGGC...
Embodiment 2
[0084] Example 2. Expression and purification of trophoblast cell surface antigen 2 protein
[0085] 1) Transfection of HEK293T cells (purchased from Shanghai Cell Bank, BNCC338274): 18 hours before transfection, HEK293T cells were treated with 1.5x10 7 / ml spread to 30 15cm culture dishes; take 37.5mL DMEM (purchased from Gibco, C11995500CP) (without serum and antibiotics) to a 50mL tube, add 2970μg polyetherimide (PEI) MegaTran 1.0 (purchased from AlfaAesar , 9002-98-6) and mix; take 37.5mL DMEM (without serum and antibiotics) to a 50mL tube, add 990μg of trophoblast cell surface antigen 2 plasmid DNA and mix; add PEI / DMEM solution to the prepared DNA solution, mix quickly and stand at room temperature for 15 minutes; respectively take 2.5ml PEI / DNA / DMEM mixture into each culture dish and store at 37°C, 5% CO 2 cultured in an incubator. After 6 hours of transfection, carefully aspirate the culture medium, and add 25ml of new culture medium DMEM+2%FBS (purchased from Gibco,...
Embodiment 3
[0089] Example 3. Preparation and preliminary screening of trophoblast surface antigen 2 monoclonal antibody This part of the work was completed by Nanjing GenScript, and the purified full-length trophoblast surface antigen 2 recombinant protein obtained in Example 2 was used according to the standard method (hereinafter referred to as trophoblast surface antigen 2 antigen) was used for immunization, cell fusion, screening, etc. of B6 / C57 mice to obtain 7 monoclonal strains.
[0090] The corresponding fusion plate cell lines are 5H3, 6H5, 6A7, 6E12, 8F5, 8A11, 8H12, and the corresponding monoclonal antibodies are labeled with this.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


