Primer, fluorescent probe and method for detecting target nucleic acid sequences

A target nucleic acid sequence and fluorescent probe technology, applied in the field of genetic engineering, can solve the problems of interference superposition, affecting the interpretation of melting curve, high fluorescence background, etc., and achieve the effect of clear interpretation and background background reduction

Inactive Publication Date: 2017-10-20
赣州市箬稞科技有限公司
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, when the fluorescent probe melting curve technology uses multiple fluorescent probes in the same fluorescent channel for detection, even if the fluorescent probes are not combined with the target sequence, the probes themselves or between the probes will entangle and mishybridize under low temperature conditions. Background signal, the background signals of multiple fluorescent probes interfere with each other and superimpose, resulting in an excessively high fluorescent background, which affects the interpretation of the melting curve

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, fluorescent probe and method for detecting target nucleic acid sequences
  • Primer, fluorescent probe and method for detecting target nucleic acid sequences
  • Primer, fluorescent probe and method for detecting target nucleic acid sequences

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1 Method for detecting target nucleic acid sequence based on fluorescence energy resonance transfer (FRET)

[0029] see Figure 1~2 , is a structural schematic diagram of a primer or a universal primer and a fluorescent probe for detecting a target nucleic acid sequence of the present invention.

[0030] The primer can be designed as a forward primer or a reverse primer. In this example, it is a reverse primer with a quencher group BHQ1 modified near the 3' end. The fluorescent probe is complementary to the different single strands of the primer and DNA, and the near 3' end is modified with the fluorescent group FAM, which can be quenched by the quenching group on the primer, so that the fluorescence intensity decreases ( figure 1 ).

[0031] The 3' end of the forward and reverse enrichment primers is reverse complementary to the template, and the 5' end is the binding site of the universal primer. The universal primer can be designed as a forward primer o...

Embodiment 2

[0039] Example 2 Using Quencher Modified Primers and Fluorescent Group Modified Probes to Detect Different Concentrations of Target Sequence Templates

[0040] According to the principle of Example 1 of the present invention, the method of this example is used to detect different concentrations of target sequence templates to evaluate its practicability.

[0041] The target sequence template is an artificial plasmid containing the PCR amplification region, which was synthesized by Sangon Technology (Shanghai) Co., Ltd. and diluted to 10 3 / ul, 10 4 / ul different concentrations.

[0042] The instrument used is Shanghai Hongshi Slan-96p fluorescence quantitative PCR instrument.

[0043] The primer sequences are:

[0044] STD-F: TCAGCAACTAGCTTACCATC (SEQ ID No: 1), the penultimate T at the 3' end modifies the BHQ1 quenching group

[0045] STD-R: GCTGACGTTGCAAGAAGACG (SEQ ID No: 2)

[0046] The fluorescent probe sequence is:

[0047] STD-P: TGATCATGTAATGGAAGGGGCAAGA (SEQ ID No...

Embodiment 3

[0057] Example 3 Detection of Target Sequence Templates at Different Concentrations Using Fluorophore-Modified Primers and Quencher-Modified Probes

[0058] According to the principle of Example 1 of the present invention, the method of this example is used to detect different concentrations of target sequence templates to evaluate its practicability.

[0059] The target sequence template is an artificial plasmid containing the PCR amplification region, which was synthesized by Sangon Technology (Shanghai) Co., Ltd. and diluted to 10 3 / ul, 10 4 / ul different concentrations.

[0060] The instrument used is Shanghai Hongshi Slan-96p fluorescence quantitative PCR instrument.

[0061] The primer sequences are:

[0062] STD-F: TCAGCAACTAGCTTACCATC (SEQ ID No: 1), the penultimate T at the 3' end

[0063] Modified FAM Fluorophore

[0064] STD-R: GCTGACGTTGCAAGAAGACG (SEQ ID No: 2)

[0065] The fluorescent probe sequence is:

[0066] STD-P: TGTAATGGAAGGGGCAAGA (SEQ ID No: 3), ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a primer, a fluorescent probe and a method for detecting target nucleic acid sequences. Quenching groups or fluorescent groups are modified at proximal ends 3' of the primer, fluorescent groups or quenching groups are modified at proximal ends 3' of the fluorescent probe, the to-be-detected nucleic acid sequences are used as templates, PCR (polymerase chain reaction) is carried out by the aid of the primer and the fluorescent probe, and dissolution curves are analyzed after the reaction is carried out, can be plotted and can be used for detecting the target nucleic acid sequences. The primer, the fluorescent probe and the method have the advantages that the method is high in specificity and sensitivity, background signals among probes are free of mutual interference, and accordingly multiple PCR can be clearly interpreted.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and more specifically, the invention relates to a primer, a fluorescent probe and a method for detecting a target nucleic acid sequence. Background technique [0002] Fluorescent PCR technology is a common technique for detecting target nucleic acid sequences. Currently, commonly used fluorescent PCR detection methods include Taqman probe method, molecular beacon (Molecular Beacon) probe method, fluorescent hybridization double probe (Hybridization Probe) method, etc. Among them, the fluorescent hybridization dual-probe method mainly uses two fluorescent probes that can hybridize with the same single strand of the target sequence, one of which is modified at the 3' end of one fluorescent group, and the other is modified at the 5' end of the other probe. A fluorescent group, when the target sequence exists, a large number of single-strands that can be reversed complementary to the two ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686
Inventor黄劭宋方丽张家剑邓银翔
Owner赣州市箬稞科技有限公司