Bacillus licheniformis engineering bacterium for efficiently synthetizing poly-gamma-glutamic acid

A technology of Bacillus licheniformis and glutamic acid, applied in the field of microbial metabolic engineering, can solve the problems of restricting large-scale production and high fermentation cost

Inactive Publication Date: 2017-12-22
武汉骏安生物科技有限公司
View PDF3 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the ability of Bacillus licheniformis to directly synthesize poly-γ-glutamic acid from glucose (de novo synthesis) is relatively weak. A large amount of exogenous glutamic acid needs to be added, which directly leads to the high fermentation cost of poly-γ-glutamic acid, which seriously restricts its large-scale production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus licheniformis engineering bacterium for efficiently synthetizing poly-gamma-glutamic acid
  • Bacillus licheniformis engineering bacterium for efficiently synthetizing poly-gamma-glutamic acid
  • Bacillus licheniformis engineering bacterium for efficiently synthetizing poly-gamma-glutamic acid

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0036] Example 1 Two-component regulator degU Cloning of expression elements in enhanced expression vectors

[0037] According to the genome sequence of Bacillus subtilis 168 published by NCBI, the promoter P43 gene fragment was amplified by PCR. The primers are:

[0038]P43-F: CGGGATCCCG TGATAGGTGGTATGTTTTCG

[0039] P43-R: ATTACAATATTTTACTTTAGTCACTCATGTGTACATTCCTCTC

[0040] According to the genome sequence of Bacillus licheniformis WX-02 published by NCBI, the amylase gene was amplified by PCR amy L the terminator fragment. Primers are as follows:

[0041] TamyL-F: ACGGCTGGGTAGAAATGAGATAAAAGAGCAGAGAGGACGGATT

[0042] TamyL-R: GCTCTAGAGCCGCAATAATGCCGTCGCACTG

[0043] 5×TransStart ® FastPfu buffer

[0044] PCR reaction conditions: 95°C for 5 min; 30 cycles of 95°C for 30 sec, 55°C for 30 sec, and 72°C for 1 min; extension at 72°C for 10 min; incubation at 10°C.

example 2

[0045] Example 2 two-component regulator degU Enhanced expression vector construction

[0046] (1) Using the enhanced expression element amplified in Example 1 as a template, the P43 promoter, two-component regulatory factor degU amylase gene amy L The terminator fragments are linked together. Primers are:

[0047] P43-F: CGGGATCCCG TGATAGGTGGTATGTTTTCG

[0048] TamyL-R: GCTCTAGAGCCGCAATAATGCCGTCGCACTG

[0049] 5×TransStart ® FastPfu buffer

5.0 μL

dNTPs (2.5 mmol / L)

2.5 μL

Upstream primer (10 mol / L)

1.0 μL

Downstream primer (10 mol / L)

1.0 μL

Template 1

0.5 μL

Template 2

0.5 μL

Template 3

0.5 μL

TransStart® FastPfu DNA Polymerase

0.5 μL

Add deionized water to the total system

25.0 μL

[0050] SOE-PCR reaction conditions: 95 °C for 5 min; 95 °C for 30 sec, 55 °C for 30 sec, 72 °C for 2 min, 7 cycles; 72 °C extension for 10 min (without primers); add primers to the...

example 3

[0068] Construction of Example 3 Bacillus licheniformis WX-02 / pHY-degU

[0069] First prepare the competent cells of Bacillus licheniformis WX-02, and then construct the successful pHY300 degU The enhanced expression plasmid was transformed into Bacillus licheniformis WX-02 competent cells to obtain Bacillus licheniformis WX-02 / pHY- degU strain.

[0070] The preparation method of Bacillus licheniformis WX-02 competent cell is as follows:

[0071] ① Inoculate Bacillus licheniformis WX-02 in 5 mL of LB medium, culture overnight at 37°C and 240 r / min;

[0072] ② Transfer to the growth medium with 5% inoculum amount, and culture to OD at 37 ℃, 240 r / min 600 reach 2.2;

[0073] ③ Pre-cool the bacterial solution on ice for 15 minutes, centrifuge at 5500 r / min at 4°C for 6 minutes, and collect the bacterial cells;

[0074] ④ Resuspend the cells with 30ml washing medium, centrifuge at 5500 r / min for 6 min, repeat three times;

[0075] ⑤ Add 1 mL of washing medium to resuspend ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a bacillus licheniformis engineering bacterium for efficiently synthetizing poly-gamma-glutamic acid, and belongs to the field of microbial metabolism engineering. A conventional molecular biological technique is used; on the basis of bacillus licheniformis WX-02 stored in a laboratory, a double-ingredient regulation and control factor degU is expressed in an enhanced way through external sources; the bacillus licheniformis engineering bacterium WX-02 / pHY-degU capable of efficiently synthetizing the poly-gamma-glutamic acid under the condition of no addition of an external source of glutamic acid is obtained. Liquid fermentation proves that the concentration of the poly-gamma-glutamic acid at a fermentation end point reaches 32.78 g / L; compared with that of an original bacterial strain of bacillus licheniformis WX 02, the concentration is improved by 47.59 percent; the synthesis capability of the poly-gamma-glutamic acid is obviously enhanced. The bacterial strain is preserved in CCTCC (China Center For Type Culture Collection) on May 27, 2016, and the preservation number is CCTCC NO:M2016294.

Description

technical field [0001] The invention discloses a bacillus licheniformis engineering bacterium for efficiently synthesizing poly-γ-glutamic acid, which belongs to the field of microbial metabolic engineering. Background technique [0002] Poly-γ-glutamic acid is an anionic polymer mainly synthesized by microorganisms. It has the characteristics of edibility, flocculation, moisture retention and biodegradability. It is widely used in food, medicine, environmental protection, cosmetics and agriculture. And other fields have a wide range of application value, has been highly valued by researchers at home and abroad. [0003] Poly-γ-glutamic acid is mainly produced by microorganisms, and most of them belong to the genus Bacillus. Among them, Bacillus licheniformis has attracted extensive attention from researchers at home and abroad because of its characteristics of easy cultivation and biological safety. However, the ability of Bacillus licheniformis to directly synthesize poly...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P7/62C12R1/10
CPCC07K14/32C12N9/2411C12P7/625
Inventor不公告发明人
Owner武汉骏安生物科技有限公司