Bacillus licheniformis engineering bacterium for efficiently synthetizing poly-gamma-glutamic acid
A technology of Bacillus licheniformis and glutamic acid, applied in the field of microbial metabolic engineering, can solve the problems of restricting large-scale production and high fermentation cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0036] Example 1 Two-component regulator degU Cloning of expression elements in enhanced expression vectors
[0037] According to the genome sequence of Bacillus subtilis 168 published by NCBI, the promoter P43 gene fragment was amplified by PCR. The primers are:
[0038]P43-F: CGGGATCCCG TGATAGGTGGTATGTTTTCG
[0039] P43-R: ATTACAATATTTTACTTTAGTCACTCATGTGTACATTCCTCTC
[0040] According to the genome sequence of Bacillus licheniformis WX-02 published by NCBI, the amylase gene was amplified by PCR amy L the terminator fragment. Primers are as follows:
[0041] TamyL-F: ACGGCTGGGTAGAAATGAGATAAAAGAGCAGAGAGGACGGATT
[0042] TamyL-R: GCTCTAGAGCCGCAATAATGCCGTCGCACTG
[0043] 5×TransStart ® FastPfu buffer
[0044] PCR reaction conditions: 95°C for 5 min; 30 cycles of 95°C for 30 sec, 55°C for 30 sec, and 72°C for 1 min; extension at 72°C for 10 min; incubation at 10°C.
example 2
[0045] Example 2 two-component regulator degU Enhanced expression vector construction
[0046] (1) Using the enhanced expression element amplified in Example 1 as a template, the P43 promoter, two-component regulatory factor degU amylase gene amy L The terminator fragments are linked together. Primers are:
[0047] P43-F: CGGGATCCCG TGATAGGTGGTATGTTTTCG
[0048] TamyL-R: GCTCTAGAGCCGCAATAATGCCGTCGCACTG
[0049] 5×TransStart ® FastPfu buffer
5.0 μL
dNTPs (2.5 mmol / L)
2.5 μL
Upstream primer (10 mol / L)
1.0 μL
Downstream primer (10 mol / L)
1.0 μL
Template 1
0.5 μL
Template 2
0.5 μL
Template 3
0.5 μL
TransStart® FastPfu DNA Polymerase
0.5 μL
Add deionized water to the total system
25.0 μL
[0050] SOE-PCR reaction conditions: 95 °C for 5 min; 95 °C for 30 sec, 55 °C for 30 sec, 72 °C for 2 min, 7 cycles; 72 °C extension for 10 min (without primers); add primers to the...
example 3
[0068] Construction of Example 3 Bacillus licheniformis WX-02 / pHY-degU
[0069] First prepare the competent cells of Bacillus licheniformis WX-02, and then construct the successful pHY300 degU The enhanced expression plasmid was transformed into Bacillus licheniformis WX-02 competent cells to obtain Bacillus licheniformis WX-02 / pHY- degU strain.
[0070] The preparation method of Bacillus licheniformis WX-02 competent cell is as follows:
[0071] ① Inoculate Bacillus licheniformis WX-02 in 5 mL of LB medium, culture overnight at 37°C and 240 r / min;
[0072] ② Transfer to the growth medium with 5% inoculum amount, and culture to OD at 37 ℃, 240 r / min 600 reach 2.2;
[0073] ③ Pre-cool the bacterial solution on ice for 15 minutes, centrifuge at 5500 r / min at 4°C for 6 minutes, and collect the bacterial cells;
[0074] ④ Resuspend the cells with 30ml washing medium, centrifuge at 5500 r / min for 6 min, repeat three times;
[0075] ⑤ Add 1 mL of washing medium to resuspend ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


