A kind of ammonium-resistant nitrogen-fixing microorganism with mutation of glnr protein binding site and its construction method and application

A protein binding site, nitrogen-fixing microorganism technology, applied in the field of microorganisms, can solve the problems of soil microbial activity decline, salinization, soil acidification, etc.

Active Publication Date: 2020-10-30
CHINA AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, long-term excessive application of chemical nitrogen fertilizers leads to soil acidification and salinization, and the decline of soil microbial activity has become an important factor restricting the sustainable development of agriculture.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of ammonium-resistant nitrogen-fixing microorganism with mutation of glnr protein binding site and its construction method and application
  • A kind of ammonium-resistant nitrogen-fixing microorganism with mutation of glnr protein binding site and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] 1. Construction of a nitrogen-fixing Paenibacillus strain with a mutation in the GlnR protein binding site

[0034] (1) Primers and vectors

[0035] MPnif1: GCACGATGCGTCCGGCGTAGAGGATCCGCCAACCGTGTAGACCGC;

[0036] MPnif2: TAGTCTCCGCTTATCATTCCTTCACATCTATTTTCGTC;

[0037] MPnif3: TGTGAAGGAATGATAAGCGGAGACTATTTCCC;

[0038] MPnif4:CTAAAGAGTCCATTCATTCCCTCCTCTCTA;

[0039] MPnif5:GAGGAGGGAATGAATGGACTCTTTAGCTGATCTCTC;

[0040] MPnif6: CTGCGCAAAAGACATAATCGATAAGCTTCCACCACGACTAGCCAC.

[0041] pRN5101: Thermosensitive Shuttle Plasmid, Em R , donated by the Institute of Plant Protection, Chinese Academy of Agricultural Sciences.

[0042] (2) A 313bp DNA fragment was synthesized at Genscript, Nanjing, in which the last 6 bases of the second GlnR binding site were replaced with a ClaI restriction site (lowercase in the second underline The position indicated by the letter), the fragment sequence is as follows:

[0043] TAAGCGGAGACTATTTCCCAAAATATATAATAAAAAATTAAAGTTTCTTATCTCAAAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of microorganisms, and particularly discloses an ammonium-tolerant nitrogen-fixing microorganism with the mutation of a binding site of GlnR (Glucagon Receptor) protein as well as a construction method and application thereof. According to the ammonium-tolerant nitrogen-fixing microorganism, in the genome of a paenibacillus strain, a nif (nitrogen fixation) promoter region with a length of 313bp is replaced with a nucleotide sequence as shown in SEQ ID NO. 1. The obtained ammonium-tolerant nitrogen-fixing microorganism can be used for carrying out biologicalnitrogen fixation in both ammonium-free and high-ammonium conditions; the nitrogenase activity of a paenibacillus microorganism in the high-ammonium condition is improved, the inhibition effect on thebiological nitrogen fixation in the high-ammonium condition is broken through, and the ammonium-tolerant nitrogen-fixing microorganism has a wide application prospect in agricultural production.

Description

technical field [0001] The invention relates to the field of microorganisms, in particular to an ammonium-resistant nitrogen-fixing microorganism with a mutation in the GlnR protein binding site, a construction method and application thereof. Background technique [0002] Nitrogen is the largest element necessary for plant production. Chemical nitrogen fertilizer plays a very important role in ensuring my country's grain production, vegetable planting and fruit tree cultivation. However, long-term excessive application of chemical nitrogen fertilizers leads to soil acidification and salinization, and the decline of soil microbial activity has become an important factor restricting the sustainable development of agriculture. [0003] At normal temperature and pressure, nitrogen-fixing microorganisms can use the nitrogenase enzyme in the body to reduce nitrogen in the air to ammonium for plant growth and use. However, the nitrogen fixation efficiency is affected by the ammon...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/74C12R1/01
CPCC07K14/195C12N15/74
Inventor陈三凤王天舒赵喜云关国华
OwnerCHINA AGRI UNIV