A Molecular Marker Linked to Long QTL in Wheat Flag Leaf and Its Application

A molecular marker, wheat technology, applied in the fields of molecular biology and crop genetics and breeding, can solve the problem of not many molecular markers

Active Publication Date: 2021-12-03
SICHUAN AGRI UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Previously, some scholars conducted QTL mapping for flag leaf length, and found that the related QTL existed widely in wheat. However, there are not many closely linked molecular markers related to flag leaf length traits in wheat that can be used in actual molecular breeding.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Molecular Marker Linked to Long QTL in Wheat Flag Leaf and Its Application
  • A Molecular Marker Linked to Long QTL in Wheat Flag Leaf and Its Application
  • A Molecular Marker Linked to Long QTL in Wheat Flag Leaf and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Acquisition of wheat flag leaf length QTL QFll-5B and its molecular marker KASP-5B-FLL

[0043] (1) Using the wheat line '20828' as the female parent and the wheat variety 'Chuannong 16' as the male parent, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 8 Generations, recombinant inbred lines containing 199 lines were obtained to form a genetic mapping population.

[0044] (2) Identification of the flag leaf length phenotype of the recombinant inbred line population: analyze and identify the flag leaf length of the recombinant inbred line during the wheat maturity stage, remove the individual plants at both ends of each row, collect five individual plants with the same growth, and calculate the flag leaf length. Leaf length, and get the average value, which represents the flag leaf length of the strain.

[0045] (3) 55K SNP chip analysis

[0046] a) DNA extraction: The DNA of the parent '20828', 'Chuannong 16...

Embodiment 2

[0055] Example 2 Application of Molecular Marker KASP-5B-FLL in Selection and Control of Flag Leaf Length QTL QFll-5B

[0056] (1) The common wheat line '20828' with long flag leaves was used as the female parent, and the common wheat line 'Chuanmai 60' with short flag leaves was used as the male parent to construct a recombinant inbred line, and 54 lines were randomly selected from the offspring lines .

[0057] (2) Carry out KASP-5B-FLL marker detection on the obtained 54 strains, the specific method is: extract the DNA of 54 strains; use it as a template, and use the specific primer pair of molecular marker KASP-5B-FLL Perform PCR amplification and perform fluorescence readings for primers, which are:

[0058] Primers on the FAM tag: (the underlined part is the FAM tag sequence)

[0059] 5'- GAAGGTGACCAAGTTCATGCT TTGATAGCAAAGTATGTTGC-3' (SEQ ID No. 1)

[0060] Primers on the HEX tag: (the wavy part is the HEX tag sequence)

[0061]

[0062] Universal downstream pri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of wheat molecular breeding, and specifically discloses a molecular marker for wheat flag leaf long QTL linkage and an application thereof. The invention provides a SNP molecular marker linked to wheat flag leaf long QTL QFll‑5B, which is located on the 5B chromosome long arm of RefSeqv1.0 genome version, which is the 51st position of the sequence shown in SEQ ID NO.31, polymorphism It is C / T, and can be obtained by amplifying primers with nucleotide sequences as shown in SEQ ID NO.1-3. The molecular marker can accurately track the wheat flag leaf length QTL QFll‑5B, predict the flag leaf length characteristics of wheat, and facilitate molecular design breeding. The invention also discloses a method for identifying the molecular marker, which can enhance the accuracy of the prediction of flag leaf length, so as to quickly screen out wheat varieties or lines with increased flag leaf length for breeding, which can greatly speed up the process of wheat growth. Breeding process for yielding varieties.

Description

technical field [0001] The invention relates to the fields of molecular biology and crop genetic breeding, in particular to a SNP molecular marker linked to wheat flag leaf length QTL QFll-5B and the application of the molecular marker. Background technique [0002] Common wheat (Triticum aestivum L.) is one of the most important crops in the world, and its sown area accounts for 20%-30% of the country's arable land. It is the staple food of 35% of the population. According to reports, wheat production should increase by 70% to meet future food demand. [0003] At present, the area of ​​arable land in the world is decreasing and the population is increasing. It is urgently expected that the annual wheat output will increase rapidly. The size of the yield directly depends on the photosynthesis of wheat, and the size of the flag leaf has a great influence on the photosynthesis, so the size of the flag leaf has a great influence on the final yield of wheat. Flag leaf length ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6895C12N15/11A01H5/12A01H6/46
CPCC12N15/8261C12Q1/6895C12Q2600/13C12Q2600/156
Inventor马建兰秀锦涂洋郑有良魏育明刘亚西江千涛陈国跃陈光登
OwnerSICHUAN AGRI UNIV