Supercharge Your Innovation With Domain-Expert AI Agents!

Nucleic acid aptamer for identifying grouper iridovirus infected cells and construction method and application thereof

A nucleic acid aptamer and iridescent virus technology, applied in biochemical equipment and methods, instruments, analytical materials, etc., can solve the problems of unsatisfactory rapid and accurate detection and diagnosis, expensive instrument reagents, cumbersome operation, etc., and achieve easy transportation and storage , short preparation cycle, simple and quick operation

Pending Publication Date: 2020-04-28
GUANGXI ACAD OF SCI +1
View PDF14 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The detection results of PCR technology are accurate and reliable, but there are disadvantages such as cumbersome operation, long time-consuming, expensive instruments and reagents, etc., which cannot meet the requirements of rapid and accurate detection and diagnosis on site

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer for identifying grouper iridovirus infected cells and construction method and application thereof
  • Nucleic acid aptamer for identifying grouper iridovirus infected cells and construction method and application thereof
  • Nucleic acid aptamer for identifying grouper iridovirus infected cells and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 Screening and preparation of nucleic acid aptamers for detection of grouper iridescent virus

[0022] S1. Construction of random single-stranded DNA (ssDNA) library and synthesis of primers

[0023] A random ssDNA library Library50 was constructed, with fixed sequences at both ends and random sequences in the middle 50 nucleotides. The nucleotide sequence is as follows:

[0024] 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC.

[0025] The sequence of the 5' primer used is as follows: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3',

[0026] The sequence of the 3' primer used is as follows: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3'.

[0027] The random ssDNA library and primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0028] S2.SELEX screening (equivalent to positive screening)

[0029] Dissolve 10 nmol of the above random ssDNA library in 500 μL PBS, place in a constant temperature water bath at 92°C for 5 min, then quickly insert it into ice, and ...

Embodiment 2

[0048] 2.1 Main Instruments

[0049] Attune NxT flow cytometer (Thermo Fisher Scientific), FV3000 laser scanning confocal microscope (Olympus).

[0050] 2.2 Experimental operation

[0051] The nucleic acid aptamers of SEQ ID NO.2 constructed in Example 1 were respectively labeled with hydroxyfluorescein (FAM).

[0052] Test group: put 10nmol of FAM-labeled aptamer of SEQ ID NO.2 in 500 μL PBS, in a constant temperature water bath at 92°C for 5 minutes, then quickly insert it into ice, and put the aptamer of SEQ ID NO.2 after treatment into ice for 10 minutes. The nucleic acid aptamer was incubated with SGIV virus-infected grouper splenocytes on ice for 1 h, and after the incubation was completed, the supernatant was removed by centrifugation.

[0053] Control group: put 10 nmol of FAM-labeled aptamer of SEQ ID NO.2 in 500 μL of PBS, in a constant temperature water bath at 92°C for 5 minutes, then quickly insert it into ice, and put it in ice bath for 10 minutes. Nucleic aci...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a nucleic acid aptamer for identifying grouper iridovirus infected cells. The nucleic acid aptamer has the following nucleotide sequences: TGAAGTTCAGGTTACTGCGCGCGCGTCTATTGCATGTCGGCCGAGCTGGT. The aptamer provided by the invention is small in molecular weight, short in preparation period, good in reproducibility, convenient for in-vitro chemical synthesis and marking, stablein sequence and easy to transport and store. The nucleic acid aptamer has high specificity and affinity to grouper iridovirus, and has no immunogenicity.

Description

technical field [0001] The invention belongs to the technical field of detection of aquatic pathogens, and in particular relates to a nucleic acid aptamer for identifying grouper iridescent virus-infected cells, its construction method and application. Background technique [0002] Marching to the sea and fully promoting the development of the marine economy has become an important strategy of our country. Guangxi is an international transportation hub connecting ASEAN and adjacent to major consumer markets for seafood such as Southeast Asia. The mariculture industry has developed rapidly in recent years. Among them, the grouper has delicate meat and rich nutrition. As a large and valuable marine fish, the current domestic annual production of grouper farming has reached more than 130,000 tons, and the direct output value of the industry has exceeded 10 billion yuan, with extremely high economic value. However, with the increase of grouper breeding density and the expansion...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115G01N33/569
CPCC12N15/115G01N33/56983C12N2310/16
Inventor 李鹏飞余庆刘明珠肖贺贺吴思婷德蒂·费兹瑞恩塞亚·普察陈波
Owner GUANGXI ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More