CRISPR system and application thereof to mortierella alpina

A technology of Mortierella alpina and nuclease, applied in the field of bioengineering, can solve problems such as low efficiency and no CRISPR knockout system

Inactive Publication Date: 2021-04-02
JIANGNAN UNIV
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are three kinds of Cpf1 widely used, which are derived from Acidaminococcus sp., Lachnospiraceae bacterium (LbCpf1) and Francisella novicida respectively. The gene is relatively inefficient and there is no CRISPR knockout system for Mortierella alpina

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR system and application thereof to mortierella alpina
  • CRISPR system and application thereof to mortierella alpina
  • CRISPR system and application thereof to mortierella alpina

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Construction of expression vector pBIG2-Pcbh1-LbCpf1

[0047] The selected nuclease is from LbCpf1 of Lachnospiraceae. A SV40 nuclear localization sequence (CCCAAGAAGAAGCGCAAGGTCC) was added at the end of the nuclease sequence. The entire fragment was biosynthesized by GenScript after codon optimization. The nucleotide sequence is shown in SEQ ID NO.1. After the synthesized LbCpf1 nuclease fragment was digested and purified by NheI and XhoI, a high-purity and high-concentration gene fragment was obtained, which was integrated into the binary vector pBIG2 in Mortierella alpina which had also been digested by T4 ligase The plasmid pBIG2-Pcbh1-LbCpf1 was obtained on -ura5-Pcbh1-ITs-TrpCT.

Embodiment 2

[0048] Example 2 Construction of Mortierella alpina Binary Expression Vector pBIG2-ura5-Pcbh1-ITs-TrpCT

[0049] The selected inducible promoter Pcbh1 (shown in SEQ ID NO.2) was derived from Trichoderma reesei, and the sequence was synthesized by GenScript Biotechnology Co., Ltd., and was digested with XbaI and the pBIG2-ura5 plasmid constructed in the laboratory (detailed See the paper "Studies on Transcriptional Regulation and Reducing Power of Mortierella Alpina Fatty Acid Synthesis Process" published in 2015) was constructed as pBIG2-ura5-Pcbh1-ITs-TrpCT. The specific enzyme cleavage reaction and ligation reaction are as follows:

[0050] 1.1 Enzyme digestion reaction: On the basis of the plasmid pBIG2-ura5-ITs, the promoter H550 of the H550-ITs-TrpCT fragment was replaced with Pcbh1 to obtain Pcbh1-IT-TrpCT (for the construction of ITs-TrpCT, see the doctoral thesis "Mortierella alpina Transcriptional Regulation and Reducing Power of Fatty Acid Synthesis Process"). At 3...

Embodiment 3

[0059] Example 3 Construction of expression vector pBIG2-ura5-Pcbh1-LbCpf1-TrpCT-SNR52p-CrRNA

[0060] Design the guide strand CrRNA for the nuclease LbCpf1 targeting gene ura5. In CasOFFinder, the relevant parameters for the guide strand are set as: the operating microorganism is Mortierella alpina ATCC 32222: PAM sequence 5'-3'TTTN of LbCpf1: target The directional gene is ura5 fragment; the length of the guide strand fragment is 23bp. For the core functional conserved region of the ura5 gene, two guide strands that can cover the region to the greatest extent and have a higher score are selected. The specific information is: the off-target score of the guide strand is 62.9, and the CrRNA corresponding to LbCpf1 covers 207bp-231bp of the ura5 fragment. The nucleotide sequence of CrRNA is shown in SEQID NO.4.

[0061] The function of the guide strand of the CRISPR system requires the guidance of RNA polymerase III (polymerase III, pol III) promoters, but there is no relevant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CRISPR system and an application thereof to mortierella alpina, and belongs to the technical field of bioengineering. Nuclease adopted in the invention is LbCpf1 of Lachnospiraceae bacterium, an inducible promoter used in the invention is cbh1 in Trichoderma reesei, a selected targeting gene is uracil gene ura5, and a starting strain used in the invention is a mortierellaalpina uracil auxotrophic type MAU1. According to the mortierella alpina system based on a CRISPR technology, provided by the invention, no significant difference between biomass and fat production content and wild fungi can be realized, polygene expression can be achieved, and the method can provide a technical means for constructing recombinant mortierella alpina with high industrial value.

Description

technical field [0001] The invention relates to a CRISPR system and its application in Mortierella alpina, belonging to the technical field of bioengineering. Background technique [0002] Mortierella alpina is an oleaginous filamentous fungus with industrial value and high arachidonic acid production. At present, the lipid production pathway of Mortierella alpina has been basically clarified, and the functions of multiple lipid production-related genes in it have been successfully verified. In order to further construct high-yielding strains, researchers need to introduce key lipid-producing genes with verified functions into the Mortierella alpina genome by means of multi-gene expression. Currently, gene expression in Mortierella alpina is limited to two gene levels. Due to the limitations of transformation methods and screening markers, traditional co-transformation methods and multi-operon methods cannot be applied to Mortierella alpina. Traditional screening marker r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/55C12N15/80C12N15/90C12N15/53C12N1/15C12R1/645
CPCC12N9/22C12N15/80C12N15/902C12N9/0071C12Y114/19C12N2800/22
Inventor陈海琴王顺贤常璐璐张灏陈永泉陈卫
OwnerJIANGNAN UNIV