GRNA primer for targeted knockout of ATG5 gene, expression system, cell strain and construction method

Abstract

The invention relates to the technical field of biology, in particular to a gRNA primer for targeted knockout of ATG5 genes, an expression system and a cell strain. According to the invention, the gRNA primer of the targeted ATG5 gene is determined. The sequence of the first target spot sequence T1 is AGTGGATAATCTTTATGGCATGG, and the sequence of the first target spot sequence T1 is The sequence of the second target spot sequence T2 is TCATGACAACATGCTGACAGTGG, and the sequence of the second target spot sequence T2 is the total protein of the ATG5 gene knockout human vascular endothelial cell strain, which is constructed by the invention, can be used for detecting autophagy effect proteins LC3-I / LC3-II, p62 and Beclin-1; the result shows that the expression of the autophagy effect protein is enhanced; the fact shows that the ATG5 gene is successfully knocked out by the cell strain constructed by the invention, the expression of the ATG5 gene is silenced, and the cell strain can be applied to the action mechanism of the ATG5 gene for causing transformation and apoptosis from endothelial cells to mesenchymal.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to gRNA primers, expression systems, and cell lines for targeted knockout of the ATG5 gene. Background technique [0002] As an evolutionarily conserved process, autophagy maintains intracellular homeostasis by degrading functionally redundant or damaged intracellular organelles in lysosomes. Many studies have shown that autophagy plays an important role in a variety of physiological and pathological processes, including cell growth, cell differentiation and proliferation, immune response, cancer, neurodegeneration and aging, etc., and the autophagy pathway has become a potential target for many diseases. access to therapy. [0003] The autophagy-related gene ATG5 is an important part of the autophagosome. Through the formation of ATG5 complex with ATG12, the autophagosome can be extended. Autophagy-related gene ATG5 plays an important role in cell development, cell differentiation an...

AI Technical Summary

Problems solved by technology

[0004] Endothelial cell injury is a key risk factor for vascular diseases, and autophagy of endothelial cells is essential for the integrity of endothelial cells. Disruption of endothelial autophagy may induce tissue and organ fibrosis, but no research has reported vascular endothelial Does ATG5 gene knockout in cells play an important role in autophagy and thus affect endothelial cell to mesenchymal transition and apoptosis

Images