Check patentability & draft patents in minutes with Patsnap Eureka AI!

GRNA primer for targeted knockout of ATG5 gene, expression system, cell strain and construction method

A construction method and expression system technology, which can be used in artificial cell constructs, DNA/RNA fragments, animal cells, etc., and can solve problems such as tissue and organ fibrosis, affecting endothelial cell transformation, etc.

Active Publication Date: 2021-06-22
XINXIANG MEDICAL UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Endothelial cell injury is a key risk factor for vascular diseases, and autophagy of endothelial cells is essential for the integrity of endothelial cells. Disruption of endothelial autophagy may induce tissue and organ fibrosis, but no research has reported vascular endothelial Does ATG5 gene knockout in cells play an important role in autophagy and thus affect endothelial cell to mesenchymal transition and apoptosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GRNA primer for targeted knockout of ATG5 gene, expression system, cell strain and construction method
  • GRNA primer for targeted knockout of ATG5 gene, expression system, cell strain and construction method
  • GRNA primer for targeted knockout of ATG5 gene, expression system, cell strain and construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0040] The present invention will be further described below in combination with specific embodiments. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

[0041] The following example provides a kind of ATG5 gene knockout HUVEC cell line based on CRISPR / Cas9 gene knockout technology, and the specific construction method is:

[0042] 1. Determine the basic information of the knockout gene:

[0043] Knockout gene name (Ensemble): ATG5 (ENSG00000057663), knockout target transcript (Ensemble number): ATG5-209 (ENST00000636335.1), its sequence information is shown in SEQ ID NO.9...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, in particular to a gRNA primer for targeted knockout of ATG5 genes, an expression system and a cell strain. According to the invention, the gRNA primer of the targeted ATG5 gene is determined. The sequence of the first target spot sequence T1 is AGTGGATAATCTTTATGGCATGG, and the sequence of the first target spot sequence T1 is The sequence of the second target spot sequence T2 is TCATGACAACATGCTGACAGTGG, and the sequence of the second target spot sequence T2 is the total protein of the ATG5 gene knockout human vascular endothelial cell strain, which is constructed by the invention, can be used for detecting autophagy effect proteins LC3-I / LC3-II, p62 and Beclin-1; the result shows that the expression of the autophagy effect protein is enhanced; the fact shows that the ATG5 gene is successfully knocked out by the cell strain constructed by the invention, the expression of the ATG5 gene is silenced, and the cell strain can be applied to the action mechanism of the ATG5 gene for causing transformation and apoptosis from endothelial cells to mesenchymal.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to gRNA primers, expression systems, and cell lines for targeted knockout of the ATG5 gene. Background technique [0002] As an evolutionarily conserved process, autophagy maintains intracellular homeostasis by degrading functionally redundant or damaged intracellular organelles in lysosomes. Many studies have shown that autophagy plays an important role in a variety of physiological and pathological processes, including cell growth, cell differentiation and proliferation, immune response, cancer, neurodegeneration and aging, etc., and the autophagy pathway has become a potential target for many diseases. access to therapy. [0003] The autophagy-related gene ATG5 is an important part of the autophagosome. Through the formation of ATG5 complex with ATG12, the autophagosome can be extended. Autophagy-related gene ATG5 plays an important role in cell development, cell differentiation an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/85C12N5/10C12N5/071
CPCC12N15/113C07K14/47C12N5/069C12N2310/20Y02A50/30
Inventor 白义春李宁姚三巧任文杰安珍姜碧杰李玉春赵英政李海斌董新文
Owner XINXIANG MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More