Application of SHANK3 fragment sequence methylation detection reagent in preparation of diagnostic kit for schizophrenia

A diagnostic kit and technology for schizophrenia, applied in biochemical equipment and methods, microbiological determination/inspection, etc., can solve the difficulties of accurately finding biomarkers for schizophrenia, the difficulty of schizophrenia, and the lack of diagnostic spirit Diagnosis of schizophrenia and other issues, achieving good application prospects

Active Publication Date: 2021-11-19
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the lack of diagnostic markers for schizophrenia is an important reason for the current difficulty in schizophrenia diagnosis
Pinpointing biomarkers that diagnose schizophrenia is difficult due to the high complexity of the brain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of SHANK3 fragment sequence methylation detection reagent in preparation of diagnostic kit for schizophrenia
  • Application of SHANK3 fragment sequence methylation detection reagent in preparation of diagnostic kit for schizophrenia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1. Using biomarkers to diagnose schizophrenia

[0033] 1. Gene name: SHANK3

[0034] 2. Fragment sequence (144bp in length, the two CGs underlined are hypermethylated sites):

[0035] TCAGCTGCACCACTCAGGCCAGGCCAGTGGCCTTGGGAGGGGCCTGTGATGCTGGGACCACAGTTCCTGGGCAGGGAGCAAC CG TCTAGGCGTGGGGAGAACGCAGGA CG TGACCCACACACCGCACTGGAGGCTCCGCTCTGC (SEQ ID NO. 1)

[0036] The above-mentioned hypermethylated sites are the CGs at the 83rd and 84th positions and the CGs at the 109th and 110th positions of the fragment sequence respectively.

[0037] 3. Experimental method

[0038] Induced pluripotent stem cells (iPSCs) from 5 patients with schizophrenia and 4 normal controls were prepared by reprogramming technology, and induced into cortical interneurons. In these neurons, it was verified that the methylation level of the above-mentioned gene fragment sequence was significantly increased in patients with schizophrenia compared with normal controls, proving that the increased...

Embodiment 2

[0055] Example 2. Using biomarkers to diagnose schizophrenia

[0056] In addition to detecting the increased methylation level of the above fragment sequence of the SHANK3 gene promoter in the cortical interneurons of Example 1; schizophrenia can also be diagnosed by detecting the increased methylation level of the above fragment sequence of the SHANK3 gene promoter in peripheral mononuclear cells disease.

[0057] In summary, the present invention found that the 144bp fragment sequence of the SHANK3 gene promoter can be used as a biomarker for the diagnosis of schizophrenia. Compared with healthy people, the methylation levels of the 83rd and 84th CGs and the 109th and 110th CGs of this fragment sequence were significantly increased in patients with schizophrenia. Therefore, the fragment sequence methylation detection reagent with a length of 144bp of the SHANK3 gene promoter can be used to prepare a schizophrenia diagnostic kit for early diagnosis of schizophrenia, and has ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides application of an SHANK3 fragment sequence methylation detection reagent in preparation of a diagnostic kit for schizophrenia, belonging to the technical field of in-vitro diagnostic reagents. The research finds that a fragment sequence with a length of 144 bp in a SHANK3 gene promoter can be used as a biomarker for diagnosing schizophrenia. Compared with healthy people, the methylation levels of CG at the 83<rd> and 84 sites and CG at the 109 and 110 sites of the fragment sequence of a schizophrenia patient are obviously increased. Therefore, the methylation detection reagent for the fragment sequence with the length of 144 bp in the SHANK3 gene promoter can be used for preparing the diagnosis kit for schizophrenia, is used for early diagnosis of schizophrenia, and has good application prospects.

Description

technical field [0001] The invention belongs to the technical field of in vitro diagnostic reagents, and in particular relates to the application of a SHANK3 fragment sequence methylation detection reagent in the preparation of a diagnostic kit for schizophrenia. Background technique [0002] Schizophrenia (SCZ) is a chronic disabling encephalopathy characterized by damage to thinking, emotion, volition, etc. It usually occurs in late adolescence or early adulthood, and its lifetime prevalence is about 1%. , can seriously affect the patient's life, work, study and social function. However, the pathophysiological mechanism of schizophrenia has not been fully elucidated so far, and the diagnosis and classification criteria of schizophrenia are still based on the patient's clinical symptoms and behavioral description, lacking a reliable biological basis to guide clinical diagnosis and treatment, which greatly limits the Objective diagnosis, early intervention and effective tre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883
CPCC12Q1/6883C12Q2600/154
Inventor 李涛倪培艳
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap