Application of SHANK3 fragment sequence methylation detection reagent in preparation of diagnostic kit for schizophrenia
A diagnostic kit and technology for schizophrenia, applied in biochemical equipment and methods, microbiological determination/inspection, etc., can solve the difficulties of accurately finding biomarkers for schizophrenia, the difficulty of schizophrenia, and the lack of diagnostic spirit Diagnosis of schizophrenia and other issues, achieving good application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1. Using biomarkers to diagnose schizophrenia
[0033] 1. Gene name: SHANK3
[0034] 2. Fragment sequence (144bp in length, the two CGs underlined are hypermethylated sites):
[0035] TCAGCTGCACCACTCAGGCCAGGCCAGTGGCCTTGGGAGGGGCCTGTGATGCTGGGACCACAGTTCCTGGGCAGGGAGCAAC CG TCTAGGCGTGGGGAGAACGCAGGA CG TGACCCACACACCGCACTGGAGGCTCCGCTCTGC (SEQ ID NO. 1)
[0036] The above-mentioned hypermethylated sites are the CGs at the 83rd and 84th positions and the CGs at the 109th and 110th positions of the fragment sequence respectively.
[0037] 3. Experimental method
[0038] Induced pluripotent stem cells (iPSCs) from 5 patients with schizophrenia and 4 normal controls were prepared by reprogramming technology, and induced into cortical interneurons. In these neurons, it was verified that the methylation level of the above-mentioned gene fragment sequence was significantly increased in patients with schizophrenia compared with normal controls, proving that the increased...
Embodiment 2
[0055] Example 2. Using biomarkers to diagnose schizophrenia
[0056] In addition to detecting the increased methylation level of the above fragment sequence of the SHANK3 gene promoter in the cortical interneurons of Example 1; schizophrenia can also be diagnosed by detecting the increased methylation level of the above fragment sequence of the SHANK3 gene promoter in peripheral mononuclear cells disease.
[0057] In summary, the present invention found that the 144bp fragment sequence of the SHANK3 gene promoter can be used as a biomarker for the diagnosis of schizophrenia. Compared with healthy people, the methylation levels of the 83rd and 84th CGs and the 109th and 110th CGs of this fragment sequence were significantly increased in patients with schizophrenia. Therefore, the fragment sequence methylation detection reagent with a length of 144bp of the SHANK3 gene promoter can be used to prepare a schizophrenia diagnostic kit for early diagnosis of schizophrenia, and has ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com