Supercharge Your Innovation With Domain-Expert AI Agents!

Use of the shank3 fragment sequence methylation detection reagent in the preparation of a diagnostic kit for schizophrenia

A schizophrenia, methylation technology, applied in biochemical equipment and methods, microbial determination/examination, etc., can solve the difficulty of accurately finding biomarkers for diagnosing schizophrenia, the difficulty of schizophrenia, the lack of diagnosis of schizophrenia Diagnosis of schizophrenia and other issues to achieve good application prospects

Active Publication Date: 2022-05-24
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the lack of diagnostic markers for schizophrenia is an important reason for the current difficulty in schizophrenia diagnosis
Pinpointing biomarkers that diagnose schizophrenia is difficult due to the high complexity of the brain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of the shank3 fragment sequence methylation detection reagent in the preparation of a diagnostic kit for schizophrenia
  • Use of the shank3 fragment sequence methylation detection reagent in the preparation of a diagnostic kit for schizophrenia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1. Diagnosis of schizophrenia using biomarkers

[0033] 1. Gene name: SHANK3

[0034] 2. Fragment sequence (144bp in length, two underlined CGs are hypermethylation sites):

[0035] TCAGCTGCACCACTCAGGCCAGGCCAGTGGCCTTGGGAGGGGCCTGTGATGCTGGGACCACAGTTCCTGGGCAGGGAGCAAC CG TCTAGGCGTGGGGGAGAACGCAGGA CG TGACCCACACACCGCACTGGAGGCTCCGCTCTGC (SEQ ID NO. 1)

[0036] The above hypermethylation sites are the CGs at positions 83 and 84 and the CGs at positions 109 and 110 in the fragment sequence, respectively.

[0037] 3. Experimental method

[0038] Using reprogramming technology, induced pluripotent stem cells (iPSCs) derived from 5 patients with schizophrenia and 4 normal controls were prepared and induced into cortical interneurons. In these neurons, it was verified that the methylation level of the above gene segment was significantly increased in schizophrenia patients compared with normal controls, proving that the increased methylation level of this segment can ...

Embodiment 2

[0055] Example 2. Diagnosis of schizophrenia using biomarkers

[0056] In addition to detecting the elevated methylation level of the above-mentioned fragment sequence of the SHANK3 gene promoter in the cortical interneurons of Example 1; schizophrenia can also be diagnosed by detecting the elevated methylation level of the above-mentioned fragment sequence of the SHANK3 gene promoter in peripheral monocytes disease.

[0057] In conclusion, the present study found that the fragment sequence of SHANK3 gene promoter with a length of 144 bp can be used as a biomarker for diagnosing schizophrenia. Compared with healthy people, the methylation levels of CG at positions 83 and 84 and CG at positions 109 and 110 were significantly increased in schizophrenia patients. Therefore, the SHANK3 gene promoter fragment sequence methylation detection reagent with a length of 144 bp can be used to prepare a schizophrenia diagnostic kit for early diagnosis of schizophrenia, and has a good appl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides the use of a SHANK3 fragment sequence methylation detection reagent in the preparation of a diagnostic kit for schizophrenia, and belongs to the technical field of in vitro diagnostic reagents. The present invention finds that the 144bp fragment sequence of the SHANK3 gene promoter can be used as a biomarker for diagnosing schizophrenia. Compared with healthy people, the methylation levels of the 83rd and 84th CGs and the 109th and 110th CGs of this fragment sequence were significantly increased in patients with schizophrenia. Therefore, the fragment sequence methylation detection reagent with a length of 144bp of the SHANK3 gene promoter can be used to prepare a schizophrenia diagnostic kit for early diagnosis of schizophrenia, and has a good application prospect.

Description

technical field [0001] The invention belongs to the technical field of in vitro diagnostic reagents, in particular to the use of a SHANK3 fragment sequence methylation detection reagent in the preparation of a schizophrenia diagnostic kit. Background technique [0002] Schizophrenia (schizophrenia, SCZ) is a type of chronic disabling encephalopathy characterized by impairments in thinking, emotion, volitional behavior, etc., mostly in late adolescence or early adulthood, and its lifetime prevalence is about 1%. , can seriously affect the patient's life, work, study and social function. However, the pathophysiological mechanism of schizophrenia has not been fully elucidated so far. The diagnosis and classification criteria of schizophrenia are still based on the clinical symptoms and behavioral descriptions of patients, lacking a reliable biological basis to guide clinical diagnosis and treatment, which greatly limits the Objective diagnosis, early intervention and effective...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883
CPCC12Q1/6883C12Q2600/154
Inventor 李涛倪培艳
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More