Use of the shank3 fragment sequence methylation detection reagent in the preparation of a diagnostic kit for schizophrenia
A schizophrenia, methylation technology, applied in biochemical equipment and methods, microbial determination/examination, etc., can solve the difficulty of accurately finding biomarkers for diagnosing schizophrenia, the difficulty of schizophrenia, the lack of diagnosis of schizophrenia Diagnosis of schizophrenia and other issues to achieve good application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1. Diagnosis of schizophrenia using biomarkers
[0033] 1. Gene name: SHANK3
[0034] 2. Fragment sequence (144bp in length, two underlined CGs are hypermethylation sites):
[0035] TCAGCTGCACCACTCAGGCCAGGCCAGTGGCCTTGGGAGGGGCCTGTGATGCTGGGACCACAGTTCCTGGGCAGGGAGCAAC CG TCTAGGCGTGGGGGAGAACGCAGGA CG TGACCCACACACCGCACTGGAGGCTCCGCTCTGC (SEQ ID NO. 1)
[0036] The above hypermethylation sites are the CGs at positions 83 and 84 and the CGs at positions 109 and 110 in the fragment sequence, respectively.
[0037] 3. Experimental method
[0038] Using reprogramming technology, induced pluripotent stem cells (iPSCs) derived from 5 patients with schizophrenia and 4 normal controls were prepared and induced into cortical interneurons. In these neurons, it was verified that the methylation level of the above gene segment was significantly increased in schizophrenia patients compared with normal controls, proving that the increased methylation level of this segment can ...
Embodiment 2
[0055] Example 2. Diagnosis of schizophrenia using biomarkers
[0056] In addition to detecting the elevated methylation level of the above-mentioned fragment sequence of the SHANK3 gene promoter in the cortical interneurons of Example 1; schizophrenia can also be diagnosed by detecting the elevated methylation level of the above-mentioned fragment sequence of the SHANK3 gene promoter in peripheral monocytes disease.
[0057] In conclusion, the present study found that the fragment sequence of SHANK3 gene promoter with a length of 144 bp can be used as a biomarker for diagnosing schizophrenia. Compared with healthy people, the methylation levels of CG at positions 83 and 84 and CG at positions 109 and 110 were significantly increased in schizophrenia patients. Therefore, the SHANK3 gene promoter fragment sequence methylation detection reagent with a length of 144 bp can be used to prepare a schizophrenia diagnostic kit for early diagnosis of schizophrenia, and has a good appl...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap