Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant baculovirus for expressing porcine parvovirus VP2 protein as well as preparation method and application of recombinant baculovirus

A technology for recombining baculovirus and parvovirus, applied in the biological field, can solve the problems of endotoxin contained in the product, unable to form correct spatial structure, affecting activity, etc.

Pending Publication Date: 2022-03-01
JIANGSU NANNONG HI TECH
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Prokaryotic expression system can be used to achieve low-cost large-scale production of proteins, but often cannot form the correct spatial structure, affecting activity, and the product contains endotoxin, which limits the application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant baculovirus for expressing porcine parvovirus VP2 protein as well as preparation method and application of recombinant baculovirus
  • Recombinant baculovirus for expressing porcine parvovirus VP2 protein as well as preparation method and application of recombinant baculovirus
  • Recombinant baculovirus for expressing porcine parvovirus VP2 protein as well as preparation method and application of recombinant baculovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] 1. Construction and acquisition of recombinant vectors

[0034] Referring to the VP2 sequence of the PPV-NADL-2 strain gene (KF049424.1), the insect cell tropism was optimized, and the optimized sequence was added with a 6×His tag at the carboxy-terminal as SEQ ID No: 1, and the primers were designed using bioinformatics software. A secretory peptide and a kozak sequence were added to the N-terminus of the VP2 gene.

[0035] Upstream primer F1 (SEQ ID No: 3):

[0036] GTGTACATTTCTTACATCTATGCGGCCACCATGTCCGAGAATGT;

[0037] F2 (SEQ ID No: 4):

[0038] TAGTCAACGTTGCCCTTGTTTTTTATGGTCGTGTACATTTCTACATC;

[0039] F3 (SEQ ID No: 5):

[0040] CCG AGATCT ATGAAATTCTTAGTCAACGTTGCCCT (the underlined part is the BglⅡ restriction site);

[0041] Downstream primer R1 (SEQ ID No:6):

[0042] GAC GCGGCCGC CTAATGATGATGATGATGATGAT (the underlined part is the Not I restriction site).

[0043] The amplified VP2 sequence (SEQ ID No: 2) and the pVL1392 vector were digested with BglⅡ...

Embodiment 2

[0049] 1. Preparation of porcine parvovirus VP2 protein vaccine

[0050] The concentration of the VP2 protein purified in Example 1 was measured, filtered, and the ratio of antigen and Gel02 adjuvant was emulsified at a ratio of 4:1 to prepare a vaccine. The content of VP2 antigen per ml of vaccine was 20 μg.

[0051] 2. Safety evaluation of porcine parvovirus VP2 protein vaccine

[0052] Ten female Balb / C mice weighing 16-18 g were divided into two groups, A and B, with 5 mice in each group. Each mouse in group A was subcutaneously injected with 0.3mL of the prepared VP2 protein vaccine; each mouse in group B was injected with 0.3ml of dialysis buffer (20mM Tris, 200mM NaCl); continuous observation for 14 days, the two groups of mice were in the same state and There was no abnormal reaction, which indicated that the vaccine was safe for mice.

[0053] Six PPV-negative pigs about 2 months old were randomly divided into two groups, A and B, with 3 pigs in each group. Each pi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant baculovirus for expressing porcine parvovirus VP2 protein as well as a preparation method and application of the recombinant baculovirus. The preservation number of the recombinant baculovirus is CCTCC NO: V202178. The recombinant baculovirus for expressing the VP2 protein is obtained by cloning a VP2 gene of a strain into a vector pVL1392 and co-transfecting an sf9 cell with a recombinant plasmid and a flashBac-ultra baculovirus gene. The porcine parvovirus VP2 protein recombinant baculovirus vaccine can induce relatively strong immune response, can provide clinical protection against porcine parvovirus and inhibit virus replication in a body, and the immunogenicity and the protective efficacy of the porcine parvovirus VP2 protein recombinant baculovirus vaccine are equivalent to those of commercial vaccines. The method for preparing the VP2 protein is simple and convenient, the production period is short, and the immune efficacy is strong.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a recombinant baculovirus expressing porcine parvovirus VP2 protein, a preparation method and application. Background technique [0002] Porcine parvovirus (PPV) is a non-enveloped single-stranded DNA virus belonging to the family Parvoviridae and the genus Parvovirus. PPV can cause reproductive disorders in sows, characterized by infertility, abortion, stillbirth, mummified fetuses and weak piglets. PPV was first isolated in my country in 1983, and PPV infection has occurred in many places since then. PPV has strong infectivity and strong resistance to the external environment, and often mixes with other diseases to infect pigs. Studies have shown that the detection rate of the disease in some pig herds can reach 85%, which has caused huge losses to the pig industry in my country. [0003] The prevention and treatment of PPV in my country is mainly based on immune prevention. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/015C12N15/866A61K39/23A61P31/20
CPCC07K14/005C12N15/86A61K39/12A61P31/20C12N2750/14022C12N2750/14034C12N2710/14043A61K2039/552
Inventor 施丽薇肖澄周琳缪芬芳董彦鹏胡静雅胡芳朱盼盼
Owner JIANGSU NANNONG HI TECH