Recombinant probiotic bacteria for the prevention and treatment of inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS)

a probiotic and inflammatory bowel disease technology, applied in the field of gut inflammatory diseases, can solve the problems of limited efficacy, inability to fully understand the mechanisms involved in the pathogenesis of ibd, and decreased disease activity in crohn's disease patients treated with il-10 recombinant i>l. lactis /i>, so as to improve the efficacy of treatment and ensure the effect of safety and better efficiency

Inactive Publication Date: 2012-08-02
UNIV PARIS DIDEROT PARIS 7 +2
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0008]The invention is based on the discovery that the use of a food-grade bacterium to deliver an anti-inflammatory molecule such as trappin-2 provides a safety and better efficiency than existing treatments. A better choice in the nature of the anti-inflammatory molecule to be delivered by L. lactis, could thus considerably improve the efficacy of treatment. Here, the inventors propose to use a food-grade bacterium to express and deliver anti-protease trappin-2 into the gut.

Problems solved by technology

The treatment of chronic inflammatory disorders such as IBD represents a major medical challenge as they afflict several millions of persons.
In addition, the mechanisms involved in the pathogenesis of IBD are not fully understood, and the development of more effective treatments or even cures for IBD depends upon better understanding the regulation of the inflammatory response.
However, the decreased disease activity in Crohn's disease patients treated with IL-10 recombinant L. lactis was somehow limited.
This limited efficacy could be explained by the fact that IL-10 delivery has always been reported to have only discrete beneficial effects against the development of colitis [Braat, H. et al., 2003].

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant probiotic bacteria for the prevention and treatment of inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS)
  • Recombinant probiotic bacteria for the prevention and treatment of inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS)
  • Recombinant probiotic bacteria for the prevention and treatment of inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS)

Examples

Experimental program
Comparison scheme
Effect test

example

Material & Methods

[0084]Cloning of Elafin in recombinant lactic acid bacteria (Lactococcus lactis and Lactobacillus casei)

Cloning and Expression of Elafin in Lactic Acid Bacteria

[0085]Gene coding for elafin was PCR amplified from plasmid DK6-elafin. Sequences of primers used were: 5′ forward Elafin (CCAATGCATCAGCAGCTGTCACGGG AGTTCC) (SEQ ID No 1) and 3′ reverse-Elafin (GGACTAGTCCTCACTGGGGAACGAAACA GGCC) (SEQ ID No 2). Primers were designed to eliminate first codons of elafin region encoding for signal peptide (SP) and was replaced by the SP of Usp45 protein (PSUsp45), the main secreted protein from L. lactis. To that aim, PCR product was digested, purified, and cloned in pSEC, a L. lactis secretion vector. In the resulting plasmid pSEC:elafin, elafin is fused in frame with a DNA fragment encoding for RBS and PSUsp45. Expression of the cassette is controlled by the inducible promoter PnisA, the activity of which depends upon the concentration of nisin used. This plasmid was then intr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
pHaaaaaaaaaa
pHaaaaaaaaaa
Login to View More

Abstract

The present invention relates to the general field of therapy of Inflammatory Bowel Disease (IBD) and / or Irritable Bowel Syndrome (IBS). Thus, the invention relates to a molecule selected from the trappin-2 protein or an active fraction thereof, a member of the WAP family proteins or an active fraction thereof or a member of the Serpin family proteins or an active fraction thereof for the treatment of Irritable Bowel Syndrome (IBS). The invention also relates to a recombinant food-grade bacterium comprising a gene selected from a gene coding for the trappin-2 protein or an active fraction thereof, a gene coding for a member of the WAP family proteins or an active fraction thereof, or a gene coding for a member of the Serpin family proteins or an active fraction thereof.

Description

RELATED APPLICATIONS AND INCORPORATION BY REFERENCE[0001]This application is a continuation-in-part application of international patent application Serial No. PCT / EP2011 / 050489 filed 14 Jan. 2011, which published as PCT Publication No. WO 2011 / 086172 on 21 Jul. 2011, which claims benefit of European patent application Serial No. 10305045.6 filed 14 Jan. 2010.[0002]The foregoing applications, and all documents cited therein or during their prosecution (“appln cited documents”) and all documents cited or referenced in the appln cited documents, and all documents cited or referenced herein (“herein cited documents”), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. More specifically, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A61K35/74C12N1/21A61P29/00A61P1/00A61P15/00A61P13/00A61P11/00C07K14/81A61P19/02
CPCA61K35/74C07K14/811C07K14/81C07K14/8125C12N15/746C07K14/8121A61P1/00A61P1/04A61P11/00A61P13/00A61P15/00A61P19/02A61P29/00A23L33/135A61K9/0053C12R2001/225A23V2200/324
InventorVERGNOLLE, NATHALIESALLENAVE, JEAN-MICHELLANGELLA, PHILIPPEBERMUDEZ-HUMARAN, LUIS
OwnerUNIV PARIS DIDEROT PARIS 7