Genetic test for liver copper accumulation in dogs and low copper pet diet
a technology of liver copper and gene testing, applied in biochemistry apparatus and processes, instruments, drug compositions, etc., can solve the problems of liver cirrhosis, liver failure, and chronic hepatitis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Elucidation of SNPs Associated with Susceptibility to Copper Accumulation
[0244]120 Labrador DNA samples were genotyped across more than 22000 SNPs. There were 72 dog samples from high copper dogs (liver levels of copper above 600 mg / kg) and 48 dog samples from normal copper liver levels (below 400 mg / kg). The data was analysed using pairwise comparison between every possible pair of dogs. Data was ordered according to support of a disease informative locus. Data from the best three genomic locations was used using Boolean operators to find the best fitting markers linked to high copper levels. Results of a simple Boolean model using the three locations are given below:
TABLE IResults of simple Boolean model using the genomic locations CFA8,CFA32 and CFAXCFA8CFA32CFAX% of dogs with(GOLGA5(UBL5(ATP7athis pattern ofgenegenegenealleles that haveregion)region)region)high copper1xx69.0%11x72.3%11181.5%Of the 27 dogs withall three alleles,22 (81.5%) have highcopper11060.0%10x64.9%10177.8%10...
example 2
[0249]The three genes identified in Example 1 were investigated to identify further SNPs associated with susceptibility to liver copper accumulation. Thirty three amplicons covering every exon of the three identified genes were chosen. These were amplified in 72 samples of genomic DNA from dogs of the Labrador Retriever breed. The samples were taken from dogs with either high copper (liver levels of copper above 600 mg / kg) or normal copper liver levels (below 400 mg / kg). The amplified product was sequenced in both directions by the Sanger method. The software ‘Seqman 4.0’ supplied by DNASTAR was used to assemble the sequence in each amplicon. The assembly was then examined to find single base variations (SNPs). These variations were then genotyped by examining the base-intensity at the SNP in the sequence from both directions. If the genotypes of a SNP from the two directions disagreed in more than 10 samples the SNP was classed as an artefact and ignored. The identified susceptibil...
example 3
[0253]The ATP7a SNP in Table VI was genotyped in samples of DNA from dogs of other breeds in addition to Labrador Retriever to determine whether the SNP is present in other breeds. Table VIII show the results, with the number of dogs of each genotype. The ‘T’ column refers to homozygote females (TT) and hemizygote males (T). The results demonstrate that the SNP is present in diverse dog breeds and therefore may be used as in indicator of protection from copper accumulation in a wide variety of different breeds, mixed bred dogs and mongrels. The T allele of the SNP has also been found in US and Japanese Labrador populations, demonstrating that geographical location of the dog is not a hindrance to the utility of the SNP.
TABLE VSequence of further SNPs indicative of susceptibility to liver copper accumulation.SEQSNP nameIDSequence to the LeftFirstSecondSequence to Right(SNP no.)NO:of the SNPAlleleAlleleof the SNPATP7a_Reg4_F_9131CTCTCATTTTGTGTATTGATTTGAGACCCTTAGTTCCCAAGTTCCTATCTTG(SNP...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
| predictive power | aaaaa | aaaaa |
| concentrations | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More