Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for preparing recombination porcine alpha-type interferon

An interferon and recombinant protein technology, applied in the field of research and development of recombinant porcine alpha-type interferon, can solve the problems of difficult industrial production, high cost of leukocyte IFN, and easy contamination of blood sources.

Active Publication Date: 2011-10-26
ANHUI JIUCHUAN BIOTECH +1
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, porcine white blood cell IFN is the first to be used in veterinary clinics in China. However, the cost of white blood cell IFN obtained by blood cell separation is relatively high, and the blood source is easily polluted, making it difficult to carry out industrial production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0067] Production process of recombinant porcine α-IFN:

[0068] 1. Construct the cloning vector:

[0069] The target gene of porcine α-type IFN is:

[0070] TCACTCCTTCTTCCTGAGTCTGTCTTGCAGGTTTGTGGAGGAAGAGAAGGCTCTCATGACTTCTGCCCTGAC

[0071] GATCTCCCAGGCACAGGGGCTGTAGCTTTCTCTTGCAGATAGAGGGTGAGTCTGTGGAAGTATTTCTCAC

[0072] AGCCAGGATGGAGTCTCTCCTCCAGCAGGGGGGTCCCTTCCAGCCCGGCCTCCTGCATGACACAGGCTTCCAG

[0073] GTCCCTGAGCTGCTGATCCAGTCCAGTGCAGAACTGGTGCAGGAGGCTCTCATCCCAGGCAGCAGCCGAGCC

[0074] CTCTGTGCTGAAGAGCTGGAAGGTCTGCTGGAGCATCTCATGCACCAGAGCCATGGCTTGAGCCTTCTGGAC

[0075] CTGGTTGCCCCCCAAGGCCTCTTgGGGGAATCCAAAGTCCCTTCTGTGGTCCAGGCAGGAGAAGGGGGAGAT

[0076] TCTCCTCATTTGTGCCAGGAGCCTCAGGGCCCTGGTGTGAGCCAGGCTGTGGGTCTGAGGCAGGTCGCA

[0077] Specific primer sequence: Upstream: GAATTC TGCGAC CTGCCT CAGACC CA

[0078] Downstream: CTCGAG TCACTC CTTCTT CCTGAG TC

[0079] After amplifying the target gene of porcine α-type IFN by PCR with specific primers, clone the target gene into pMD18-Tsimple v...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing porcine recombinant IFN-alpha. The method is to use a special primer - PCR to amplify target genes of the porcine IFN-alpha, to connect the target genes with an expression vector - pET-28a and an expression vector - pGEX-5X, to transform colon bacillus, to make the colon bacillus highly efficiently express the porcine IFN-alpha and to prepare porcinerecombinant IFN-alpha freeze-dried injection through the techniques such as high purification, sterilization, split charging, freeze-drying and so on. The method is shown to have obvious treatment effect on porcine virus diarrhea, influenza and so on and be superior to similar products in the aspects of safety and cure rate through safety experiment, IFN efficacy inspection and clinic probation. The preparation technique is simple; industrialized production is easy; transportation and preservation are easy after freeze-drying. After the porcine recombinant IFN-alpha is injected into a porcinebody, the porcine recombinant IFN-alpha is characterized by good healing effect, reliable assembly, no side effect like inocuity and so on, can be used for curing diseases like the porcine virus diarrhea, the influenza and so on, and is novel high-efficient safe nonpersistent broad-spectrum antiviral preparation.

Description

technical field [0001] The invention relates to a preparation method and process of recombinant porcine α-type interferon (interferon, IFN). It is made by transforming the recombinant plasmid with porcine α-IFN gene into Escherichia coli, and making it highly express porcine α-IFN. After purification, it is made by adding appropriate amount of porcine plasma albumin stabilizer and lyophilized. It is used for the treatment of porcine viral diarrhea and epidemics. Viral diseases such as influenza. The standards for development and verification are all using the national SFDA-certified recombinant human α-IFN (China Biological Products Regulations, China Biological Products Standardization Committee, edition 2000) as a reference and implemented. Background technique [0002] Porcine viral disease is the main infectious disease that seriously restricts the healthy development of pig breeding industry. Occurs throughout the year, such as swine viral diarrhea and influenza. Onc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/21C12N15/70C07K14/56C07K1/14
Inventor 王明丽
Owner ANHUI JIUCHUAN BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products