Primer, kit and method for differentiating fins of different spieces of sharks by polymerase chain reaction and restriction fragment length polymorphism analysis (PCR-RFLP)

A technology of PCR-RFLP and kits, applied in biochemical equipment and methods, microbe determination/testing, DNA/RNA fragments, etc., to achieve high-sensitivity effects

Inactive Publication Date: 2011-03-09
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF1 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] At present, there are few reports at home and abroad that can quickly

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, kit and method for differentiating fins of different spieces of sharks by polymerase chain reaction and restriction fragment length polymorphism analysis (PCR-RFLP)
  • Primer, kit and method for differentiating fins of different spieces of sharks by polymerase chain reaction and restriction fragment length polymorphism analysis (PCR-RFLP)
  • Primer, kit and method for differentiating fins of different spieces of sharks by polymerase chain reaction and restriction fragment length polymorphism analysis (PCR-RFLP)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] In this example, universal primers for different species of sharks were designed based on the mitochondrial 16S rDNA sequences of Sharkia and teleosts.

[0033] The inventors of the present invention have conducted a comprehensive analysis of the mitochondrial 16S rDNA gene sequences of different species of sharks and bony fishes in the NCBI database Shark class, based on GeneBank numbers AB015962.1, AJ310141.1, FJ853422.1, Y18134.1 Conserved sequences were compared by ClustalW software to find out the same sequence of their conserved sequences, so as to design corresponding primers.

[0034] After multiple comparisons, tests and verifications, a large number of primer pairs were screened to obtain the following two pairs of primers: The first round of primers:

[0035] SK-F11: CTCAGCCATCTTACCTGTGGCAAT (SEQ ID No. 1)

[0036] SK-R11 CYCCTCCTGCTGGGTCAAAG (SEQ ID No. 2)

[0037] Second round of primers:

[0038] Sharkfin-F2: CTACAAACCACAAAGATATCGGCACC (SEQ ID No. 3)

...

Embodiment 2

[0043] Nested PCR reactions were performed using universal primer pairs for sharks and teleosts. After each round of PCR, the quality of the total DNA extracted from the sample was tested to provide a suitable template for subsequent RFLP analysis.

[0044] The nest PCR reaction primer pair sequence that is used to detect Sharkidae and bony fish used in the present embodiment is:

[0045] The first round of primers consisted of SEQ ID No.1 and SEQ ID No.2, and the second round of primers consisted of SEQ ID No.3 and SEQ ID No.4.

[0046] By detecting the mitochondrial 16S rDNA sequence, test the extraction quality of the total DNA of the sample and provide a suitable template for the enzyme digestion reaction. The reaction system of Nest PCR in this example is: the first round of PCR reaction conditions is 94°C pre-denaturation for 8 minutes; 94°C for 30s, 50°C for 30s, 72°C for 60s, 35 cycles, and 2% agarose electrophoresis after the reaction Analysis; the second round of PC...

Embodiment 3

[0066] In this embodiment, PCR-RFLP analysis is performed on shark samples through the following experiments.

[0067] The digested product used in this example is the end product of the PCR reaction obtained by the nested PCR method described in Example 2.

[0068] The specificity of the shark primers can be determined by digesting the mitochondrial 16S rDNA sequence. A total of 20 μL of the entire reaction system: ddH 2 O 7.5 μL, 10×NEB Buffer 2 μL, AluI 0.5 μL, PCR reaction product 10 μL. Water bath at 37°C for 2h; after enzyme digestion, inactivate the enzyme activity in a 65°C oven for 10min. After the reaction, 4% agarose electrophoresis analysis was performed.

[0069] The main detection instruments used:

[0070] Micropipette (10 μL, 100 μL, 1000 μL Eppendorf), high-speed desktop centrifuge (Pico17 Thermo), high-speed pulverizer (IKA-WEARKE GERMANY), nucleic acid and protein analyzer (DYY-6C Beijing Liuyi Instrument Factory), water bath, Ordinary PCR instrument, e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to oligo nucleotide for differentiating fins of different species of sharks, a method for detecting differentiating fins of different species of sharks by polymerase chain reaction and restriction fragment length polymorphism analysis (PCR-RFLP), a detection kit for differentiating fins of different species of sharks by the PCR-RFLP, and application of the oligo nucleotide in identifying fins of different species of sharks. The oligo nucleotide primer, the detection kit and the PCR-RFLP detecting method can simply, quickly, specifically and sensitively detect the fins of different species of sharks.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular, the invention relates to oligonucleotide primers, kits, polymerase chain reaction-restriction fragment length polymorphism analysis (polymerase chain reaction and restriction fragment length polymorphism analysis (PCR-RFLP) detection method, and the application of said oligonucleotide primer in different species shark fins. Background technique [0002] Shark's fin, seafood cooking raw material, also known as shark's fin, sand shark's fin, golden silk dish, is a product made from the fins of cartilaginous fishes such as sharks or plow rays. It is mainly made of cartilage in the fins (also known as wing tendons, wing needles) for feeding, including dorsal, pectoral, pelvic, anal, dorsal, and caudal fins. [0003] There are many types of shark fins, and the names of the north and the south are very inconsistent, and there is no unified classification. There are usually three classifica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
Inventor 黄文胜韩建勋邓婷婷陈颖
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap