A small interfering RNA for the treatment of psoriasis
A psoriasis, small interference technology, applied in DNA/RNA fragments, gene therapy, recombinant DNA technology, etc., can solve the problem of unclear genes, unclear pathogenesis of psoriasis, and no cure for drugs or technical procedures for treatment, etc. problem, to reduce the effect of
Inactive Publication Date: 2018-07-10
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF1 Cites 0 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
The pathogenesis of psoriasis is still unclear so far, the genes involved are even less clear, and there is no radical drug or treatment technology process for treatment
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreExamples
Experimental program
Comparison scheme
Effect test
Embodiment 1
Embodiment 2
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
Login to View More Abstract
The invention belongs to the field of biotechnology, and in particular relates to a short, double-stranded ribonucleic acid, namely small interfering RNA (siRNA), for treating psoriasis. The small interfering RNA (siRNA) for treating psoriasis of the present invention has the following sequence: target sequence: 5'-3'aaactgtgagtggtcagcttt sense strand: 5'-3'acugugaguggucagcuuuTT antisense strand: 3'-5'TTugacacaccagucgaaa according to the present invention The siRNA used in the treatment of psoriasis can effectively reduce the production of target proteins, thereby blocking the pathogenesis of psoriasis, and its therapeutic effect is remarkable.
Description
technical field The invention belongs to the field of biotechnology, and in particular relates to a short, double-stranded ribonucleic acid, namely small interfering RNA (siRNA), for treating psoriasis. Background technique Psoriasis, commonly known as psoriasis, is a chronic autoimmune skin disease characterized by severe scaly erythema, which cannot be completely cured at present, and the exact cause of psoriasis has not yet been clarified. In addition, existing treatments also have certain limitations, such as inconvenience, limited efficacy, toxicity, and high cost. According to the 2006 study "Psoriasis and Psoriatic Arthritis: Strategic Analysis of the Market" by Kalorama Information in the United States, the number of patients with psoriasis and psoriatic arthritis in the United States is about 7.8 million; it is estimated that in 2016 The number of people with psoriasis and psoriatic arthritis in the United States will reach 8.5 million. In the normal population,...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113A61K48/00A61P17/06
Inventor 郭骁才
Owner CHENGDU INST OF BIOLOGY CHINESE ACAD OF S