Unlock instant, AI-driven research and patent intelligence for your innovation.

A small interfering RNA for the treatment of psoriasis

A technology of psoriasis and small interference, applied in the direction of DNA/RNA fragments, gene therapy, recombinant DNA technology, etc., can solve the problem of unclear genes, no radical medicine or treatment technology process, unclear pathogenesis of psoriasis, etc. problems, to achieve the effect of blocking the disease process and reducing the occurrence of

Inactive Publication Date: 2015-09-09
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The pathogenesis of psoriasis is still unclear so far, the genes involved are even less clear, and there is no radical drug or treatment technology process for treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A small interfering RNA for the treatment of psoriasis
  • A small interfering RNA for the treatment of psoriasis
  • A small interfering RNA for the treatment of psoriasis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Triple distilled water (d 3 h 2 O), add 0.2 milliliters of DEPC to every 100 milliliters of triple distilled water, incubate at room temperature for 5 hours, then prepare DEPC water by autoclaving at 121.4 DEG C for 15 minutes. Dissolve the small interfering RNA with DEPC water so that the final concentration of the small interfering RNA is 10nM, which is the small interfering RNA liquid, which is divided into 0.5ml small packages and stored at minus 60°C for future use. The rubbing method and treatment process are as follows.

[0033] Wipe 0.5ml small interfering RNA liquid every time per 500 square centimeters every day. Soak the psoriasis lesions with hot water or wet hot towels first, soak the skin softly, remove dandruff and keratinized dead skin. The frozen small interfering RNA liquid was taken and naturally melted into a liquid at room temperature (15-25° C.), and then the small interfering RNA liquid was applied to the skin lesions.

[0034] Volunteer Xu, m...

Embodiment 2

[0036] The preparation of the small interfering RNA liquid, the wiping method and the treatment process are as in Example 1.

[0037] Volunteer Liu, male, 39 years old. Treat 1 skin lesion on the left side of the chest, once a day, 0.5 ml. Medication for 45 days. About 70% of the area of ​​skin lesions subsided.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology and particularly relates to short double-stranded ribose nucleic acid, namely small interfering ribose nucleic acid (siRNA) for treating psoriasis. The siRNA for treating the psoriasis has the following sequences of: a target sequence, namely 5'-3'aatttctgccagctccagaag, a positive-sense strand, namely 5'-3'uuucugccagcuccagaagTT and a negative-sense strand, namely 3'-5'TTaaagacggucgaggucuuc. The siRNA provided by the invention is used for treating the psoriasis and can effectively reduce target proteins, so that the pathologic process of the psoriasis is blocked and the siRNA has an obvious treatment effect.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a short, double-stranded ribonucleic acid, namely small interfering RNA (siRNA), for treating psoriasis. Background technique [0002] Psoriasis, commonly known as psoriasis, is a chronic autoimmune skin disease characterized by severe scaly erythema, which cannot be completely cured at present, and the exact cause of psoriasis has not yet been clarified. In addition, existing treatments also have certain limitations, such as inconvenience, limited efficacy, toxicity, and high cost. [0003] According to the 2006 study "Psoriasis and Psoriatic Arthritis: Strategic Analysis of the Market" by Kalorama Information in the United States, the number of patients with psoriasis and psoriatic arthritis in the United States is about 7.8 million; it is estimated that in 2016 The number of people with psoriasis and psoriatic arthritis in the United States will reach 8.5 million. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11A61K48/00A61P17/06
Inventor 郭骁才
Owner CHENGDU INST OF BIOLOGY CHINESE ACAD OF S