Insecticidal protein Cryl A. 301, expression vector and application thereof

A cry1a.301, insect-resistant protein technology, applied in the field of genetic engineering and biological control, can solve ecological imbalance, lack of insect-resistant varieties, environmental pollution and other problems, to reduce usage, expand insect-resistant spectrum, and reduce environmental pollution Effect

Active Publication Date: 2013-08-14
INST OF CROP SCI CHINESE ACAD OF AGRI SCI +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the lack of suitable insect-resistant varieties, the current main method to solve insect pests is to spray chemical insecticides during the growth process; however, chemical insecticides kill pests and their natural enemies at the same time, causing ecological imbalance and environmental pollution

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Insecticidal protein Cryl A. 301, expression vector and application thereof
  • Insecticidal protein Cryl A. 301, expression vector and application thereof
  • Insecticidal protein Cryl A. 301, expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Synthesis of Cry1A.301 gene

[0032] Through codon optimization, Cry1Ab and Cry1F were synthesized (the synthesis work was completed by Sangon Bioengineering (Shanghai) Co., Ltd.) and then the first and second functional domains of Cry1Ab and the first functional domain of Cry1F were synthesized by the SOE method (1992, Cai Yuyang). The three functional domains are spliced ​​together. It is generally believed that the Bt protein is composed of three domains. Domain I includes 250-300 amino acids at the N-terminal of the active insecticidal protein and consists of 7 α-helices, one of which is Strong hydrophobicity, located in the center of domain I, surrounded by the other six α-helices. It has been proven that it is related to the toxicity of insecticidal proteins. The hydrophobic α-helix has the ability to insert into the midgut cell membrane of sensitive insects and form pores; domain II consists of three anti-parallel β sheets to form a triangular shape st...

Embodiment 2

[0033] Example 2 Expression of Cry1A.301 gene in prokaryotic system and detection of product toxicity

[0034] In order to detect the in vitro expression of the modified Cry1A.301 gene and its toxicity to the corn borer, we constructed a Bt prokaryotic expression vector. According to the needs of cloning the Bt gene, the NdeI endonuclease recognition site sequence AAGGAGATATACATA was added to the 5' end of the primer sequence, and the XhoI endonuclease recognition site sequence GGTGGTGGTGCTCGAG was added to the 3' end. The designed primer sequence is: F: AAGGAGATATACATA TGGACAACAACCCGAAC,R: GGTGGTGGTGCTCGAG CTCGAGTGTGGCAGTAAC. Using the spliced ​​Cry1A.301 DNA as a template, the Cry1A.301 gene was amplified with adapter-added primers, and the Cry1A.301 gene fragment was recovered and purified with a gel extraction kit. Digest pET30a with restriction endonucleases NdeI and XhoI, recover and purify. The two fragments were ligated, and the resulting prokaryotic expression p...

Embodiment 3

[0046] Example 3 Expression of Cry1A.301 Gene in Transgenic Plants and Toxicity Detection of Expression Products

[0047] Add the SmaI endonuclease recognition site sequence CTCTAGAGGATCCCC and TCGAGCTCGGTACCC at the 5' and 3' ends of the primer sequence respectively, and design the primer as: F: 5' CTCTAGAGGATCCCC ATGGACAACAACCCGAAC3'; R: 5' TCGAGCTCGGTACCC CTACTCGAGTGTGGCAGTAAC 3', using the synthesized Cry1A.301 nucleotide sequence as a template, using primers with adapters to amplify, amplification program: 94°C pre-denaturation for 5 minutes, 94°C denaturation for 30s, 55°C annealing for 30s, 68°C extension for 2min, 35 cycles, extended at 68°C for 10 min, and the target fragment was recovered with a gel recovery purification kit. At the same time, the plant expression vector CPB was digested with SmaI, and the CPB fragment after digestion was recovered and purified. The two fragments were ligated (In-Fusion HD cloning kit, Clontech) to construct the eukaryotic expres...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an insecticidal protein Cryl A. 301 which has 1) an amino acid sequence shown by SEQ ID No.2; or 2) an amino acid sequence which is obtained by substituting the amino acid sequence shown by SEQ ID No.2 or decreasing and or increasing one or more amino acid(s) of the amino acid sequence shown by SEQ ID No.2, and has the same function. The experiment in vitro proves that the reformed and synthesized Bt gene toxin production protein has remarkable insecticidal effect for european corn borer. The insecticidal protein Cryl A. 301 can be efficiently expressed in monocotyledons, thus being used for producing insect-resistant transgenic plants.

Description

technical field [0001] The invention relates to the field of genetic engineering and biological control, in particular to an insect-resistant protein Cry1A.301, its expression vector and application. Background technique [0002] The Bt gene encodes an insecticidal crystal protein from Bacillus thuringing Hansis. It produces delta-endotoxin insecticidal parasporal crystal proteins during sporulation, and these proteins have high insecticidal activity. It is generally believed that the insecticidal effect of crystal proteins is divided into five steps: including dissolution, enzymatic activation, binding to receptors, insertion, hole or ion channel formation, and each step can affect the insecticidal effect of crystal proteins (Moonsom et al. , 2007). After the parasporal crystal enters the insect body, the disulfide bond is opened under the alkaline condition of the midgut, dissolved into a protoxin, and then activated into an active toxin protein under the action of tryps...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/325C12N15/32C12N15/63C12N5/10A01H5/00A01N43/50A01P7/04
Inventor李新海翁建峰杨小艳郝转芳雷开荣李明顺张德贵白丽张芳军张世煌
OwnerINST OF CROP SCI CHINESE ACAD OF AGRI SCI