A new strain of Bacillus thuringiensis and its application
A technology of Bacillus aureus and inoculum, which is applied to Bacillus thuringiensis and its application field in agricultural pest control, and can solve problems such as undiscovered resistance problems.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1 contains a variety of cry Screening and Identification of Genes in Bacillus thuringiensis
[0022] The soil was collected from the soil in Chengdu City, Sichuan Province. Using the sodium acetate-antibiotic separation method, weigh 10 g of the soil sample and put it into a shaker flask filled with 50 ml of sodium acetate medium, add penicillin sodium salt and gentamicin sulfate at 400 μg / ml each, and culture on a shaking table (200 r / min, 30℃) 4h. After the cultivation, take 10ml of soil suspension, put it into a sterile centrifuge tube and centrifuge at 3000 r / min for 15 minutes, take 2ml of the upper cloudy solution and place it in a water bath at 65°C for 15min, take 0.1ml of the heat-treated cloudy solution and spread it on a plate, and place the plate at 30°C cultured in an incubator. After 48 hours, smears of Bt-like strains were picked from the plate. A Bt strain with rhombohedral crystal morphology was found (see attached figure 1 ). Observed ...
Embodiment 2
[0023] Example 2 In strain BN23-5 cry Identification of genes
[0024] according to cry Design a pair of specific primers for the conserved sequence of class 1 genes:
[0025] K5un2 (SEQ ID NO1): AGGACCAGGATTTACAGGAGG
[0026] K3un2 (SEQ ID NO2): GCTGTGACACGAAGGATATAGCCAC
[0027] Use the following PCR reaction system for identification:
[0028] 10 × buffer 2.5μl
[0029] MgCl 2 (25mM) 1.5μl
[0030] Taq enzyme 0.2μl
[0031] dNTPs (2.5mM) 2μl
[0032] Primer 2μl
[0033] Template 5 μl μ
[0034] Final reaction volume 25 μl
[0035] Thermal cycle reaction: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 1 min, annealing temperature depends on the primer, extension at 72°C for 2 min, 30 cycles; extension at 72°C for 5 min; stop reaction at 4°C. The amplification reaction products were electrophoresed on 1% agarose gel, and the PCR amplification results were observed in a gel imaging system. The result is as image 3 As shown, the above primers wer...
Embodiment 3
[0036] Example 3 cry1Ha-like gene cloning
[0037] Genomic DNA purification kit (purchased from Saibaisheng Company) was used to extract the total DNA of strain BN23-5; design its full-length gene primers P1 and P2 (primer sequences are as follows); Primers carry out PCR amplification, and reaction system and reaction procedure are with embodiment 2; Amplify with primer P1 and P2 cry1Ha-like The full-length gene obtained a 3507bp fragment (see attached Figure 4 ). The purified PCR product was connected to the pGEM-T vector, transformed, and positive clones containing the target fragment were picked and sequenced to obtain the sequence SEQ ID No. 1 respectively.
[0038] P1 (SEQ ID NO3): 5'ATGGAGAATAAAAATCAACAC3'
[0039] P2 (SEQ ID NO4): 5' CTATTCCTCCATAAGGAG 3'
[0040] cry1Ha-like gene sequence analysis
[0041] The full length of the sequence SEQ ID No.7 is 3507bp in length, analysis shows that the GC content is 39.58%, and it encodes a protein consisting of 1169...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


