Heparinase I fusion protein

A technology of fusion protein and heparinase, applied in the field of genetic engineering, can solve problems such as low proportion, large molecular weight, and reduced specific activity of fusion protein

Inactive Publication Date: 2013-06-19
曹林 +2
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these fusion partners have relatively large molecular weights (GST 27kD, MBP 40kD, and heparanase I 42kD), so that under the same expression level, the proportion of the active region, that is, heparanase I, is not high, which reduces the specific activity of the fusion protein; And larger fusion partner can produce steric hindrance to heparanase I, further affects the activity of fusion protein (Yin Chen et al., Production of MBP-HepA fusion protein in recombinant Escherichia coli by optimization of culture medium.Biochemical Engineering Journal2007 , vol.34:114-121)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heparinase I fusion protein
  • Heparinase I fusion protein
  • Heparinase I fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. Construction of fusion expression vector

[0035] The construction process of the fusion expression vector pFusion is as follows: figure 1 As shown, the specific process is as follows: two oligonucleotide chains are synthesized, and the sequences are respectively:

[0036] Linker sense (SEQ ID No.1)

[0037] 5' ctagc Actagt ggtggtggtggttctggtggtggtggttctgatgatgatgataaagcgg-3'

[0038] Linker antisense (SEQ ID No.2)

[0039] 5'-gatcccgctttatcatcatcatcagaaccaccaccaccagaaccaccaccacca actaggtg -3'

[0040] 100 pmol oligonucleotide chains were mixed respectively, heated at 70°C for 15 minutes, cooled naturally to room temperature, and annealed to form double strands. The pET 28a vector was digested with Nhe I and BamH I, and recovered from the gel to obtain a linearized vector. The annealed product and the linearized vector were ligated with T4 ligase, and transformed into Escherichia coli DH5α. The recombinant vector was named pLinker. The insert seque...

Embodiment 2

[0054] Example 2. Construction of Flavobacterium heparin heparanase I fusion expression vector

[0055] The construction process of Flavobacterium heparin heparinase I fusion expression vector is as follows: figure 1 As shown, the specific process is as follows: amplify the heparanase I gene from the chromosomal DNA of Flavobacterium heparinus, and the primers are:

[0056] FH F (SEQ ID No. 10): 5'-gatcggatcccagcaaaaaaaatccggtaac-3'

[0057] FH R (SEQ ID No. 11): 5'-gatcctcgagttatctggcagtttcgctgtac-3'

[0058] The PCR reaction system is: 100ng Flavobacterium heparin genomic DNA, 10pmol of each primer, 0.2mM of each dNTP, 1x amplification buffer, 2 units of pfu enzyme. The PCR reaction program was: 94°C for 5 minutes; 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 2 minutes; 72°C for 5 minutes. The PCR product was detected by 1% agarose gel electrophoresis, and the size was 1092bp.

[0059] The PCR product was double-digested with BamH I and Xho I, and then...

Embodiment 3

[0060] Example 3. Expression of Heparanase I Fusion Protein

[0061] Transform pTrx-FH Heparinase I, pSUMO-FH Heparinase I, and pIF2-FH Heparinase I into Escherichia coli BL21(DE3) competent cells respectively, and culture them on LB solid medium (containing 10 μg / ml kanamycin) at 37°C overnight. Pick a single colony to 3ml LB medium (containing 10ug / ml kanamycin), culture at 37°C until OD 600 = 0.5, add IPTG with a final concentration of 0.5 mM, and continue culturing at 16° C. for 12 hours. Collect the cells by centrifugation at 10,000 g, wash with 400 μl PBS (50 mM NaH 2 PO 4 pH 8.0, 300mM NaCl), resuspended, and ultrasonicated. Take 200μl of the lysate, centrifuge at 12,000g for 10 minutes, and collect the supernatant; use 200μl of PBS (50mM NaH 2 PO 4 pH 8.0, 300mM NaCl) resuspended. The ultrasonic total protein, ultrasonic supernatant and ultrasonic precipitation were analyzed by 12% SDS-PAGE. The expression result of Flavobacterium heparinus heparanase I fusio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides one or several heparinase I fusion proteins and coding genes thereof. The heparinase I fusion protein contains three structural domains: a fusion structural domain, a connection structural domain and a heparinase I structural domain. Specifically, the fusion structural domain is selected from thioredoxin Trx, small ubiquitin-like modifier SUMO or translation initiation factor 2IF2, and the heparinase I structural domain includes Flavobacterium heparinum heparinase I. The invention also provides expression and purification methods of the heparinase I fusion protein.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a heparanase I fusion protein. Background technique [0002] Heparinase, also known as heparin lyase, is the only enzyme known to degrade heparin. Heparinase was first discovered in Flavobacterium Heparinum, and there are three kinds of heparinase I (EC 4.2.2.7), heparinase II (EC unassigned), and heparinase III (EC 4.2.2.8 ). Among them, heparanase I uses heparin as the main substrate, heparanase II uses heparin and heparan sulfate as the substrate, and heparanase III uses heparan sulfate as the main substrate. [0003] Heparanase has extensive and important uses. Selective degradation by heparanase can help to study the structure and sequence of polysaccharides; heparanase can be used to deheparinize blood after clinical operations; heparanase can be used to prepare low molecular weight heparin. Among them, heparanase I is the main enzyme for preparing low molecular weigh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/88C12N15/62C12N15/63C12N15/70C12N1/21C12R1/20
Inventor曹林杨翔颜明
Owner曹林