Unlock instant, AI-driven research and patent intelligence for your innovation.

Rhodotorula mucilaginosa and application thereof in degradation and decoloring of dyes and production of carotenoid

A technology of Rhodotorula gum and carotene, applied in the direction of microorganism-based methods, fermentation, microorganisms, etc., can solve the problems of less research and triphenylmethane dyes that have not been reported, and achieve broad application prospects, efficient and significant degradation and decolorization effects Effect

Active Publication Date: 2013-11-27
JIANGNAN UNIV
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Triphenylmethane dyes are the third most used dyes after azo dyes and anthraquinone dyes, and are widely used in textile printing and dyeing, papermaking, leather making and other industries, but there are few studies
At present, there have been reports on the production of carotenoids by researchers using Rhodotorula gelatinosa, but the application of using Rhodotorula gelatinum to efficiently decolorize triphenylmethane dyes has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rhodotorula mucilaginosa and application thereof in degradation and decoloring of dyes and production of carotenoid
  • Rhodotorula mucilaginosa and application thereof in degradation and decoloring of dyes and production of carotenoid
  • Rhodotorula mucilaginosa and application thereof in degradation and decoloring of dyes and production of carotenoid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Screening and Separation of Rhodotorula japonicus JM401 CCTCC M 2013088

[0020] Glue Rhodotorula jM401 CCTCC M 2013088 was isolated from tobacco stems produced in Luzhou, Sichuan in October 2011; 5g of tobacco stems were placed in a 250ml sterilized Erlenmeyer flask containing 10 small glass beads, 100ml of sterile saline was added, and the mixture was heated at 30°C. Shake the culture at 150r / min for 20min on a shaker and let it stand for 2h; take the above bacterial suspension and dilute it by 10 5 、10 6 、10 7 times, take 100 μl and spread on the water-soluble aniline blue plate (the composition of the water-soluble aniline blue plate is calculated in g / L: peptone 10, yeast extract 5, sodium chloride 5, aniline blue 2, agar 15, and the remaining components are water, pH5 .5, sterilized at 121°C for 15 minutes), repeated three times for each concentration, cultured at 32°C for 40 hours, selected a single colony with a large transparent circle for multiple ...

Embodiment 2

[0022] Example 2 Identification of Rhodotorula japonicus JM401 CCTCC M 2013088

[0023] (1) Morphological characteristics

[0024] After culturing on the slant medium for 40 hours, microscopic observation: the diameter of the colony is about 2 mm, with oval protrusions, neat edges, smooth surface, sticky shape, and carotenoid pigments; in the seed medium, the strain grows for 20 hours to reach Several phases; the growth is best at 32°C.

[0025] (2) ITS-5.8S rDNA sequence analysis

[0026] The target strain was cultured on slant medium for 24 hours, and the ITS-5.8S rDNA sequence of the strain was amplified by PCR technology. The oligonucleotide primers were: TCCGTAGGTGAACCTGCGG (ITS1) and TCCTCCGCTTATTGATATGC (ITS4), and the amplified products were delivered to Shanghai Sequencing was performed by Sangon Bioengineering Technology Service Co., Ltd., and its sequence is shown in SEQ ID NO:1. The sequence results were compared with the known ITS-5.8S rDNA sequence in GeneBank...

Embodiment 3

[0037] Embodiment 3 single batch degradation decolorization culture

[0038] Take 40ml of the cultured activated seed solution, load it into two 50ml sterile centrifuge tubes, each centrifuge tube contains 20ml, centrifuge at 8000r / min for 10min, discard the supernatant, collect all the bacteria and transfer them to a 100ml Erlenmeyer flask 40ml of decolorization medium with an initial concentration of 50mg / L crystal violet, pH 6.0, cultured with shaking at 37°C for 2h at a shaker speed of 150r / min to obtain a decolorization medium. The degradation and decolorization rate of crystal violet reached 92.35%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a Rhodotorula mucilaginosa and the application thereof in the degradation and decoloring of dyes and the production of carotenoid. The Preservation No. of the Rhodotorula mucilaginosa JM401 is CCTCC NO: M 2013088; the saccharomycete can be used for carrying out degradation and decoloring on a triphenlmethane dye: and centrifugally collecting activated seed solution bacteria and vaccinating the bacteria to a decoloring medium containing the dye, and carrying out shake cultivation on the obtained product for 2-12 h at a temperature of 25-37 DEG C and a pH value of 4.0-7.5 so as to obtain a decoloring culture solution; and the saccharomycete can be used for producing carotenoids by fermentation: taking an activated seed solution and vaccinating the activated seed solution to a fermentation medium, and carrying out fermentation cultivation on the obtained product for 36-48 h at a temperature of 25-32 DEG C and a pH value of 5.0-7.0 so as to obtain fermentation liquor containing the carotenoids. The Rhodotorula mucilaginosa disclosed by the invention simultaneously has the abilities of carrying out efficient decoloring on triphenlmethane dyes and carrying out high-yield production on carotenoids, therefore, the Rhodotorula mucilaginosa has an extremely broad application prospect in a field to which the Rhodotorula mucilaginosa belongs.

Description

technical field [0001] The invention relates to a rhodotorula gum strain and its application in dye degradation and decolorization and carotenoid fermentation production, belonging to the technical field of microbes and fermentation. Background technique [0002] Dye is an important pollutant. There are 100,000 kinds of dyes in the world, and the annual output is about 0.75-1×106 tons, of which 10-15% of the dyes are discharged into the environment with wastewater. Dyes can stimulate the human eyes and digestive system, cause skin sensitivity and pain, and even lead to cancer; in addition, when dyes are discharged into water bodies, they will affect the chromaticity of water, interfere with the transmission of sunlight, and cause ecosystem disorders; some dyes also Cytotoxic to aquatic animals such as fish. Therefore, dye residues in the environment must be removed. [0003] Triphenylmethane dyes are the third most used dyes after azo dyes and anthraquinone dyes. They are...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/16A62D3/02C12P23/00C12R1/645A62D101/26
Inventor 丁重阳李国辉刘元法王玉红顾正华张梁石贵阳
Owner JIANGNAN UNIV