Pair of small guide RNAs (Ribonucleic Acids) (sgRNAs) for specifically identifying sheep DKK1 gene and coded DNA (Deoxyribonucleic Acid) and application of sgRNAs

A technology that specifically recognizes, DNA molecules

Inactive Publication Date: 2014-05-21
QINGDAO AGRI UNIV +1
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, subsequent studies have shown that Cas9 has obvious off-target effects (High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology. Fu et al, 2013; High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9nuclease specificity. Nature Biotechnology. Pattanayak et al, 2013)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pair of small guide RNAs (Ribonucleic Acids) (sgRNAs) for specifically identifying sheep DKK1 gene and coded DNA (Deoxyribonucleic Acid) and application of sgRNAs
  • Pair of small guide RNAs (Ribonucleic Acids) (sgRNAs) for specifically identifying sheep DKK1 gene and coded DNA (Deoxyribonucleic Acid) and application of sgRNAs
  • Pair of small guide RNAs (Ribonucleic Acids) (sgRNAs) for specifically identifying sheep DKK1 gene and coded DNA (Deoxyribonucleic Acid) and application of sgRNAs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Embodiment 1, the construction of sgRNA expression plasmid pair

[0021] 1. sgRNA target design

[0022] Extract a sequence of the sheep DKK1 gene from the sequence of NCBI GI: 417531892 (including the coding region of the first exon and its 5' untranslated region, region: 6667599-6667800, as shown below), and input it into the online software Target sites were designed (http: / / zifit.partners.org / ZiFiT).

[0023] 1 cgcggggact aggcgtgcaa agcgacactc ctcctttctc tttttctccc ttgagtcctt

[0024] 61 ctgagatgac ggctctgggc acagcgggtg ctgcccgggt cttggtcgcc ctggtggctg

[0025] 121 cggctctttg cggtcaccct ctgctgggag tgagcgccac cttgaacttc gttctcaact

[0026] 181 ccaacgccat caagaacacc cc

[0027] The forward target sequence is GGGCACAGCGGGTGCTGCCC (77-96) and the reverse target sequence is 5'GTCATCTCAGAAGGACTCAA3' (51-70). The two target sequences are arranged in a "head-to-head" manner, and the distance between the two is 6 bp, that is, there is a 6 bp interval. Name them as forw...

Embodiment 2

[0035] Example 2. Verifying the biological activity of the sgRNA expression plasmid pair constructed in Example 1 by sequencing

[0036] Sheep Fetal Fibroblasts (SEF): For isolation and culture methods, please refer to the literature: Meng Fanhua, Xiao Hongmei, Zhang Dong, Zhou Huanmin. Isolation, culture and characteristic analysis of Mongolian sheep fetal skin fibroblasts. "China Animal Husbandry and Veterinary Medicine" 2012 No. 3, 136- 140.

[0037] 1. Co-transfect 4 μg of each of the recombinant plasmids pX335-sgRNA-F and pX335-sgRNA-R into 1×10 6 SEF cells to obtain recombinant cells. The specific steps of transfection are as follows: use a nuclear transfer instrument (Amaxa, model: AAD-1001S) and a matching mammalian fibroblast transfection kit (Amaxa, product number: VPI-1002) for transfection. First, use 0.05% trypsin (Gibco, catalog number: 610-5300AG) to digest adherent cells, stop digestion with fetal bovine serum (Gibco, catalog number: 16000-044), and wash with...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pair of small guide RNAs (Ribonucleic Acids) (sgRNAs) for specifically identifying a sheep DKK1 gene and coded DNA (Deoxyribonucleic Acid) and application of the sgRNAs. The sgRNA pair consists of sgRNA-F and sgRNA-R, wherein the sgRNA-F and the sgRNA-R consist of 101 nucleotides respectively; 20nt RNA fragments on a 5' terminal can be used for identifying DKK1 genes on sheep chromosomes, and the remaining 81nt RNA fragments are framework RNA fragments which can be combined with Cas9n nuclease; the sgRNA-F is shown as a sequence 2 in a sequence table, and the sgRNA-R is shown as a sequence 4 in the sequence table. A Cas9 system is used for knocking out or modifying the sheep DKK1 gene on a cell or individual level in order to analyze the function of the sheep DKK1 gene and construct a sheep DKK1 gene mutation database for serving for sheep breeding.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a pair of sgRNA specifically recognizing sheep DKK1 gene, its coding DNA and application. Background technique [0002] The DKK gene family is an inhibitor of the WNT signaling pathway, and WNT signaling regulates the growth and development of hair follicles. DKK1 is an important member of the DKK gene family. Foxn1: DKK1 moderately overexpressed mice, the number of hair follicles per unit area decreased by 30%, and the hair follicles were arranged in bundles (Wnt and dkk determine hair follicle spacing through a reaction-diffusion mechanism. Science. Sick et al, 2006). Using a reaction-diffusion model, Sick et al. also predicted that decreased expression or accelerated degradation of DKK would lead to decreased hair follicle spacing (Sick et al, 2006). Consistent with this prediction, inhibition of BMP signaling leads to increased hair follicle density ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/11C40B40/08
Inventor赵金山李和刚柳楠刘积凤程明
OwnerQINGDAO AGRI UNIV