Unlock instant, AI-driven research and patent intelligence for your innovation.

A Molecular Approach to Differentiate Cherry Fruit Color

A technology for cherries and fruits, which is applied in the molecular field of distinguishing the color of cherries, achieves the effects of simple operation, easy popularization, and beneficial to auxiliary breeding.

Active Publication Date: 2017-04-19
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The color of the cherry peel is very rich, including yellow, yellow-backed blush, purple-red, etc. In the study of fruit color, genes (mutations) are the internal factors for the accumulation of different colors in fruits. How genes can distinguish cherries with different fruit colors has not yet been studied. No related reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Molecular Approach to Differentiate Cherry Fruit Color
  • A Molecular Approach to Differentiate Cherry Fruit Color
  • A Molecular Approach to Differentiate Cherry Fruit Color

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Detection of the colors of Dalong, Rainey and Rabbins by the method of the present invention

[0029] The Dalong, Rainey and Rabbins leaves were selected as experimental materials. The color of the mature peel of Dalong is yellow and the flesh is yellow; the color of the mature peel of Raney is red with a yellow background and the flesh is light yellow; figure 1 ). The specific operations are as follows:

[0030] Use Biomiga's Plant gDNA kit to extract the genomic DNA of the three materials of cherry Dalong, Raney and Labins. The method refers to the kit, electrophoresis on 0.8% agarose gel (EB), and the extracted genomic DNA is observed under ultraviolet light ( See figure 2 ).

[0031] The gene LGS was amplified by PCR method, and the PCR reaction system was used to amplify the three materials of Dalong, Raney and Labins respectively.

[0032] The upstream primer is ATGGAGGGTATAACTTGGGTGTGAGAA (Sequence Listing NO.1);

[0033] The downstream primer i...

Embodiment 2

[0038] Embodiment 2 uses the method of the present invention to detect 26 cherries of different colors

[0039] Keeping other conditions unchanged, blind testing was carried out on 26 cherries of different colors, that is, the fruit color was inferred from the molecular test results, and the inferred results were confirmed by the color of the ripe fruit. The specific operations are as follows:

[0040] Use Biomiga's Plant gDNA kit to extract cherries Royal Ann, Chelan, Critalina, Sam, B.TAR, Jiahong, Hongnanyang, Caixia, Pioneer, Hongmi, Linda, Sonata, BlackYork, Juhong, Berrant, Santina, Zao Daguo, Zaodan, Vega, Black Gold, S-106, Rainbow, 133, Dalong, Raney and Rabins. The genomic DNA of 26 leaf materials, method reference kit.

[0041] The gene LGS was amplified by PCR method. PCR reaction system: 26 genomic DNAs were taken as templates for amplification.

[0042] The upstream primer is ATGGAGGGTATAACTTGGGTGTGAGAA;

[0043] The downstream primer is TAGTCCTTCTGAACATTGGTAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular method for distinguishing colors of cherry fruits. The method comprises the steps of A, acquiring different cherry leaves, and extracting genome DNA; B, amplifying a gene LGS by using a PCR method; C, carrying out electrophoresis detection, namely carrying out electrophoresis on 0.8% of agarose gel (EB), and observing an amplified DNA fragment under an ultraviolet lamp; D, carrying out PCR product sequencing on samples with stripes; and E, distinguishing results, namely determining that a variety which is not amplified to the gene LGS is a yellow variety, a variety which can be amplified to the complete gene LGS is a purple red variety, and a variety which can be amplified to the gene LGS and is subjected to basic group A deletion on the 1214bp position is a red-yellow variety. The molecular method can be used for distinguishing three varieties including the yellow variety of cherries, the red-yellow variety of cherries and the purple red variety of cherries through one gene detection, can serve for cherry breeding and can particularly provide the technical support for rapid selection of juvenile-phase cherries.

Description

technical field [0001] The invention relates to a method for distinguishing the color of cherry fruits, in particular to a molecular method for distinguishing the color of cherry fruits. Background technique [0002] Fruit color is an important appearance quality of the fruit, and anthocyanins determine the color of most fruits and are also a sign of fruit maturity. Anthocyanins, also known as anthocyanins, are secondary metabolites produced by plants. Anthocyanins are water-soluble pigments that exist in specific tissues and cells in plants, such as the vacuoles of plant cells, and are regulated by both external and internal factors (Procissi et al., Light-dependent spatial and temporal expression of regulatory genes in developing maize seeds. The Plant Cell, 1997, 9: 1547-1557; Cominelli E et al., Expression analysis of anthocyanin regulatory genes in response to different light qualities in Arabidopsis thaliana. Journal of Plant Physiology, 2008, 165: 886-894). It is co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/29
CPCC12Q1/6895C12Q2600/13C12Q2600/156C12Q2600/158
Inventor 金万梅王晶王华张开春李茂福闫国华张晓明
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES