Indel markers associated with rose petals and molecular methods for identification of rose petals
A technology of red and petals, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., to achieve the effects of easy promotion, early seedling breeding, and simple operation techniques
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1 verifies the petal color of Yueyuehong and Tiantanbai with the method provided by the invention
[0037] The leaves of Chinese rose varieties Yueyuehong and Tiantanbai were taken as identification materials. The petals of Yueyuehong are red, and the petals of Tiantanbai are white, such as figure 1 shown.
[0038] The specific operation is as follows:
[0039] 1. Use the plant genomic DNA extraction kit DP360 to extract the genomic DNA of the leaves of Yueyuehong and Tiantanbai respectively. The extraction steps are operated according to the kit instructions. After extraction, electrophoresis identification is carried out. The results are as follows figure 2 shown.
[0040] 2. Using the extracted genomic DNA as a template, use the upstream primer SEQ ID No.3 and the downstream primer SEQ ID No.4 to perform PCR reaction amplification using a PCR amplification kit;
[0041] The upstream primer sequence (5'→3') SEQ ID No.3 is GTTGGTGCACCAGATCAAACAATTGGTGC;...
Embodiment 2
[0051] Example 2 Use the method of the present invention to verify 18 materials of the hybrid progeny population of Yueyuehong and Tiantanbai
[0052] Carry out hybridization with Yueyuehong (female parent) and Tiantanbai (male parent) in Example 1 as parents, take 18 different progeny plants in the hybrid progeny group to distinguish and verify, and then check with the real petal color of the above-mentioned materials in the field fake.
[0053] 1. Use the Plant Genomic DNA Extraction Kit DP360 to extract the genomic DNA (concentration: 20 ng / μL) of the leaves of the above-mentioned 18 different offspring plants (numbered as material 1 to material 18), and extract according to the steps provided in the kit instructions;
[0054] 2. Using the extracted genomic DNA from materials 1 to 18 as templates, use the upstream primer SEQ ID No.3 and the downstream primer SEQ ID No.4 to perform PCR reaction amplification using a PCR amplification kit;
[0055] The upstream primer sequen...
Embodiment 3
[0062] Embodiment 3 uses the method of the present invention to identify 17 different-colored rose varieties
[0063] 17 rose varieties of different colors were taken for blind testing, and the results of Indel molecular testing were used to speculate whether the flower color of the rose was red, and then the real petal colors of the above-mentioned rose varieties in the field were used to check for counterfeit.
[0064] Proceed as follows:
[0065] 1. Use the plant genomic DNA extraction kit to extract the leaf genomic DNA of 17 materials (numbered as material 1 to material 17), and the extraction is carried out according to the kit instructions;
[0066] 2. Using the extracted genomic DNA of the leaves of materials 1 to 17 as templates, use the upstream primer SEQ ID No.3 and the downstream primer SEQ ID No.4 to perform PCR reaction amplification using a PCR amplification kit;
[0067] The upstream primer sequence (5'→3') SEQ ID No.3 is GTTGGTGCACCAGATCAAACAATTGGTGC;
[00...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


