Lamp detection kit for detecting porcine rotavirus
A porcine rotavirus and kit technology, which can be used in microorganism-based methods, microorganism determination/inspection, microorganisms, etc., can solve the problems of increased mortality, long time consumption, and low mortality, and achieve strong specificity and time-consuming. Short, highly sensitive effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] The preparation of embodiment 1 kit of the present invention
[0030] 1. Materials and instruments
[0031] The same experimental materials and instruments as mentioned above.
[0032] 2. Experimental method
[0033] 2.1 Primer and template preparation
[0034] 2.1.1 Primer design
[0035] The LAMP primers designed for PoRV are shown in Table 1.
[0036] Primers are as follows:
[0037]
[0038] 2.1.2 Positive template preparation
[0039] The target gene fragment (SEQ ID NO: 5)
[0040]TAGTCGTACTTGCACCGCTCATTAAAGCTCAAAATTACGGAATTAATTTACCAATAACTGGATCTATGGATACGCCATATATGGATTCAACTACAAGTGAAACATTTTTGACTTCGACATTATGTCTATATTATCCAAATGAAGCAGCTACAGAAATTGCAGATACAAAATGGACAGAAACATTGTCGCAGTTGTTTTTAACAAAAGGATGGCCAACAGGGTCAGTTTATTTTAAAGGATATGCAGATATTGCGTCATTTTCTGTAGAACCGCAGTTATACTGCGACTATAATATTGTACTAATGAAATATGATGGAAATTTACAGTTAGACATGTCTGAATTGGCTGATTTAATATTGAATGAATGGCTATGTAATCCAATGGATATAATGCTATATTATTATCAGCAAACAGATGAAGCTAATAAATGGATATCAATGGGTACATCATGTACGATTAAAGTATGTCCTCTAAATACGCAGA...
Embodiment 2
[0085] Embodiment 2 specificity experiment
[0086] 1. Test method
[0087] The nucleic acids of TGEV, PEDV, PoRV, CSFV, PRRSV, JEV and PRV were extracted, and the optimal conditions determined in Example 1 were used for RT-LAMP detection to check its specificity. DEPC-treated water was used as a negative control.
[0088] 2. Results
[0089] Experimental results such as Figure 9As shown, only PoRV has a positive result when detected by the method of the present invention, there is no cross-reaction between TGEV, PoRV, and PEDV, and agarose gel electrophoresis presents a ladder-like band, and the reaction product has an obvious green fluorescent reaction under ultraviolet light , CSFV, PRRSV, JEV and PRV tests were all negative, there was no ladder-like band in agarose gel electrophoresis, and the reaction product had no green fluorescence reaction under ultraviolet light.
[0090] The method of the present invention can only detect PoRV virus, but not other viruses, indic...
Embodiment 3
[0091] Embodiment 3 sensitivity test
[0092] 1. Test method
[0093] The prepared positive RNA template was diluted with DEPC-treated water, and the RNA concentration of PoRV was adjusted to 1.5×10 8 copies / μL, the template was diluted 10 times, and the RT-LAMP detection was carried out according to the optimal conditions specified in Example 1, and the sensitivity test was carried out. At the same time, DEPC-treated water was used as a negative control.
[0094] 2. Results
[0095] Such as Figure 10 As shown, the detection of 10-fold serially diluted positive RNA templates shows that there are obvious ladder-like bands in lanes 1-6 and the reaction products have obvious green fluorescence reactions under ultraviolet light, and RT-LAMP of PoRV can detect 10 6 The prepared positive RNA template was diluted twice, about 150copies / μL of the sample.
[0096] Experimental result shows, adopts kit of the present invention to detect the minimum detectable concentration of PoRV ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap