Check patentability & draft patents in minutes with Patsnap Eureka AI!

Lamp detection kit for detecting porcine rotavirus

A porcine rotavirus and kit technology, which can be used in microorganism-based methods, microorganism determination/inspection, microorganisms, etc., can solve the problems of increased mortality, long time consumption, and low mortality, and achieve strong specificity and time-consuming. Short, highly sensitive effects

Inactive Publication Date: 2017-01-11
SICHUAN AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If there is maternal antibody, it is generally not easy to be infected or the clinical symptoms are mild, and the mortality rate is low; if the ambient temperature is low, secondary pathogenic Escherichia coli infection or other diarrhea virus infection, no maternal antibody protection, the infection will be serious , increased mortality
[0003] Traditional detection methods, such as virus isolation and identification and serum examination, often take too long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lamp detection kit for detecting porcine rotavirus
  • Lamp detection kit for detecting porcine rotavirus
  • Lamp detection kit for detecting porcine rotavirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The preparation of embodiment 1 kit of the present invention

[0030] 1. Materials and instruments

[0031] The same experimental materials and instruments as mentioned above.

[0032] 2. Experimental method

[0033] 2.1 Primer and template preparation

[0034] 2.1.1 Primer design

[0035] The LAMP primers designed for PoRV are shown in Table 1.

[0036] Primers are as follows:

[0037]

[0038] 2.1.2 Positive template preparation

[0039] The target gene fragment (SEQ ID NO: 5)

[0040]TAGTCGTACTTGCACCGCTCATTAAAGCTCAAAATTACGGAATTAATTTACCAATAACTGGATCTATGGATACGCCATATATGGATTCAACTACAAGTGAAACATTTTTGACTTCGACATTATGTCTATATTATCCAAATGAAGCAGCTACAGAAATTGCAGATACAAAATGGACAGAAACATTGTCGCAGTTGTTTTTAACAAAAGGATGGCCAACAGGGTCAGTTTATTTTAAAGGATATGCAGATATTGCGTCATTTTCTGTAGAACCGCAGTTATACTGCGACTATAATATTGTACTAATGAAATATGATGGAAATTTACAGTTAGACATGTCTGAATTGGCTGATTTAATATTGAATGAATGGCTATGTAATCCAATGGATATAATGCTATATTATTATCAGCAAACAGATGAAGCTAATAAATGGATATCAATGGGTACATCATGTACGATTAAAGTATGTCCTCTAAATACGCAGA...

Embodiment 2

[0085] Embodiment 2 specificity experiment

[0086] 1. Test method

[0087] The nucleic acids of TGEV, PEDV, PoRV, CSFV, PRRSV, JEV and PRV were extracted, and the optimal conditions determined in Example 1 were used for RT-LAMP detection to check its specificity. DEPC-treated water was used as a negative control.

[0088] 2. Results

[0089] Experimental results such as Figure 9As shown, only PoRV has a positive result when detected by the method of the present invention, there is no cross-reaction between TGEV, PoRV, and PEDV, and agarose gel electrophoresis presents a ladder-like band, and the reaction product has an obvious green fluorescent reaction under ultraviolet light , CSFV, PRRSV, JEV and PRV tests were all negative, there was no ladder-like band in agarose gel electrophoresis, and the reaction product had no green fluorescence reaction under ultraviolet light.

[0090] The method of the present invention can only detect PoRV virus, but not other viruses, indic...

Embodiment 3

[0091] Embodiment 3 sensitivity test

[0092] 1. Test method

[0093] The prepared positive RNA template was diluted with DEPC-treated water, and the RNA concentration of PoRV was adjusted to 1.5×10 8 copies / μL, the template was diluted 10 times, and the RT-LAMP detection was carried out according to the optimal conditions specified in Example 1, and the sensitivity test was carried out. At the same time, DEPC-treated water was used as a negative control.

[0094] 2. Results

[0095] Such as Figure 10 As shown, the detection of 10-fold serially diluted positive RNA templates shows that there are obvious ladder-like bands in lanes 1-6 and the reaction products have obvious green fluorescence reactions under ultraviolet light, and RT-LAMP of PoRV can detect 10 6 The prepared positive RNA template was diluted twice, about 150copies / μL of the sample.

[0096] Experimental result shows, adopts kit of the present invention to detect the minimum detectable concentration of PoRV ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting porcine rotavirus. The kit comprises primers as shown in SEQ ID NO: 1-4 and a gene for loop-mediated isothermal amplification of the porcine rotavirus. The invention further discloses a use of the primers as shown in SEQ ID NO: 1-4 in preparation of a reagent for detecting the porcine rotavirus. The detection kit disclosed by the invention can be used for accurately and effectively detecting the porcine rotavirus, and is high in specificity, high in sensitivity, short in time consumption and high in detection speed, so that the application prospect is good.

Description

technical field [0001] The invention relates to a LAMP detection kit for detecting porcine rotavirus. Background technique [0002] Porcine rotavirus (PoRV) contacts and colonizes the epithelial cells of the small intestine, a large number of epithelial cells are infected and destroyed, and the absorption of nutrients in the small intestine is hindered. Lead to retention of fluid in the small intestine, increased osmotic pressure in the small intestine, resulting in absorption of fluid from body tissues, causing diarrhea and dehydration symptoms, and the ultimate cause of death may be heart and kidney failure caused by dehydration, metabolic acidosis, and hyperkalemia . Porcine diarrhea caused by porcine rotavirus (PoRV) is relatively rare clinically, and the severity of porcine rotavirus infection has little relationship with age. After infection, it often presents watery or mushy diarrhea, and the color of the stool It is yellow-white or dark black, and the severity of c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/6844C12Q1/701C12Q2531/119
Inventor 曹三杰文心田朱书权黄小波文翼平伍锐梁恩涛段素芬张丹张小会
Owner SICHUAN AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More