Lamp detection kit for detecting porcine rotavirus
A porcine rotavirus and kit technology, which can be used in microorganism-based methods, microorganism determination/inspection, microorganisms, etc., can solve the problems of increased mortality, long time consumption, and low mortality, and achieve strong specificity and time-consuming. Short, highly sensitive effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] The preparation of embodiment 1 kit of the present invention
[0030] 1. Materials and instruments
[0031] The same experimental materials and instruments as mentioned above.
[0032] 2. Experimental method
[0033] 2.1 Primer and template preparation
[0034] 2.1.1 Primer design
[0035] The LAMP primers designed for PoRV are shown in Table 1.
[0036] Primers are as follows:
[0037]
[0038] 2.1.2 Positive template preparation
[0039] The target gene fragment (SEQ ID NO: 5)
[0040]TAGTCGTACTTGCACCGCTCATTAAAGCTCAAAATTACGGAATTAATTTACCAATAACTGGATCTATGGATACGCCATATATGGATTCAACTACAAGTGAAACATTTTTGACTTCGACATTATGTCTATATTATCCAAATGAAGCAGCTACAGAAATTGCAGATACAAAATGGACAGAAACATTGTCGCAGTTGTTTTTAACAAAAGGATGGCCAACAGGGTCAGTTTATTTTAAAGGATATGCAGATATTGCGTCATTTTCTGTAGAACCGCAGTTATACTGCGACTATAATATTGTACTAATGAAATATGATGGAAATTTACAGTTAGACATGTCTGAATTGGCTGATTTAATATTGAATGAATGGCTATGTAATCCAATGGATATAATGCTATATTATTATCAGCAAACAGATGAAGCTAATAAATGGATATCAATGGGTACATCATGTACGATTAAAGTATGTCCTCTAAATACGCAGA...
Embodiment 2
[0085] Embodiment 2 specificity experiment
[0086] 1. Test method
[0087] The nucleic acids of TGEV, PEDV, PoRV, CSFV, PRRSV, JEV and PRV were extracted, and the optimal conditions determined in Example 1 were used for RT-LAMP detection to check its specificity. DEPC-treated water was used as a negative control.
[0088] 2. Results
[0089] Experimental results such as Figure 9As shown, only PoRV has a positive result when detected by the method of the present invention, there is no cross-reaction between TGEV, PoRV, and PEDV, and agarose gel electrophoresis presents a ladder-like band, and the reaction product has an obvious green fluorescent reaction under ultraviolet light , CSFV, PRRSV, JEV and PRV tests were all negative, there was no ladder-like band in agarose gel electrophoresis, and the reaction product had no green fluorescence reaction under ultraviolet light.
[0090] The method of the present invention can only detect PoRV virus, but not other viruses, indic...
Embodiment 3
[0091] Embodiment 3 sensitivity test
[0092] 1. Test method
[0093] The prepared positive RNA template was diluted with DEPC-treated water, and the RNA concentration of PoRV was adjusted to 1.5×10 8 copies / μL, the template was diluted 10 times, and the RT-LAMP detection was carried out according to the optimal conditions specified in Example 1, and the sensitivity test was carried out. At the same time, DEPC-treated water was used as a negative control.
[0094] 2. Results
[0095] Such as Figure 10 As shown, the detection of 10-fold serially diluted positive RNA templates shows that there are obvious ladder-like bands in lanes 1-6 and the reaction products have obvious green fluorescence reactions under ultraviolet light, and RT-LAMP of PoRV can detect 10 6 The prepared positive RNA template was diluted twice, about 150copies / μL of the sample.
[0096] Experimental result shows, adopts kit of the present invention to detect the minimum detectable concentration of PoRV ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


