Lamp Detection Kit for Porcine Epidemic Diarrhea Virus
A porcine epidemic diarrhea and kit technology, which is applied in the determination/inspection of microorganisms, methods based on microorganisms, microorganisms, etc., can solve the problems of time-consuming and other problems, and achieve the effect of short time-consuming, strong specificity and rapid detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1 Preparation of kit of the present invention
[0038] 1. Materials and instruments
[0039] The same experimental materials and instruments as mentioned above.
[0040] 2. Experimental method
[0041] 2.1 Primer and template preparation
[0042] 2.1.1 Primer design
[0043] The LAMP primers designed for PEDV are shown in Table 1.
[0044] Primers are as follows:
[0045]
[0046] 2.1.2 Positive template preparation
[0047] The target gene fragment (SEQ ID NO: 7)
[0048] ATCTGTGAGAACCGCACTCG GATTACTCACAGCTGAGTAGTCGCCGTGTTTGGACCGGACATAGAAAGCCCAACCAGTGCCAGATGGAGCATTGACTGAACGACCAACACGTCCGTAGACAATTGTTGTAGTGGCCTTGGCGACTGTGACGAAATTAGGTAATTGACTTACCTGTACGCCAGTAGCAACCTTATAGCCCTCTACAAGCAATGTACCACTAAGGAGTGTTAGCGTTACACCAGTTGGTGCTCCAAGCACTGGAATGCAGACCTGTCGGCCCATCACAGAAGTAGTGAGAAGCGCGTCTGTTTCAGGATTGAAAGACCACCAAGAATGTGTCCTGCGCCACAACCGAATGCTATTGACAAAGTACATTATCCACAGCATAAGAGTGATGCAAGCCATAAGGATGCTGAAAGCAAAAAAGACCCAATTGACCTGAAAGCTAGCCCATGCATCAAAAAGTGACAGTGCTAACACAAG...
Embodiment 2
[0097] Embodiment 2 specificity experiment
[0098] 1. Test method
[0099] The nucleic acids of TGEV, PEDV, PoRV, CSFV, PRRSV, JEV and PRV were extracted, and the RT-LAMP detection was carried out according to the optimal conditions of Example 1 to check its specificity, and DEPC-treated water was used as a negative control.
[0100] 2. Results
[0101] Experimental results such as Figure 11-12 Adopt the method of the present invention to detect, only PEDV just has positive result, and agarose gel electrophoresis presents ladder-like band, and reaction product can be seen obvious green fluorescent reaction under ultraviolet light, and TGEV, PoRV, PEDV, CSFV, PRRSV, JEV and PRV tests were all negative, there was no ladder-like band in agarose gel electrophoresis, and the reaction product had no green fluorescence reaction under ultraviolet light.
[0102] The method of the invention can only detect PEDV virus, but not other viruses, indicating that the primers and the kit ...
Embodiment 3
[0103] Embodiment 3 Sensitivity test
[0104] 1. Test method
[0105] The prepared positive RNA template was diluted with DEPC-treated water, and the RNA concentration of PEDV was adjusted to 1.5×10 8 copies / μL, the template was diluted 10 times, and the RT-LAMP detection was performed according to the optimal conditions of Example 1, and the sensitivity test was performed, and DEPC-treated water was used as a negative control.
[0106] 2. Results
[0107] Such as Figures 13 to 14 As shown, the detection of positive RNA templates with 10-fold gradient dilution showed that there were obvious ladder-like bands in lanes 1-7 and the reaction products had obvious green fluorescence reactions under ultraviolet light, and RT-LAMP of PEDV could detect 10 7 The prepared positive RNA template was diluted twice, that is, 15copies / μL of the sample.
[0108] The experimental results show that the minimum detection concentration of PEDV detected by the kit of the present invention is 1...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap