LAMP detection kit for porcine epidemic diarrhea virus

A porcine epidemic diarrhea and kit technology, which is applied in the determination/inspection of microorganisms, methods based on microorganisms, microorganisms, etc., can solve the problems of time-consuming and other problems, and achieve the effect of short time-consuming, strong specificity and rapid detection

Active Publication Date: 2015-05-20
SICHUAN AGRI UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Traditional detection methods, such as virus isolation and identification and serum examination, often take too long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP detection kit for porcine epidemic diarrhea virus
  • LAMP detection kit for porcine epidemic diarrhea virus
  • LAMP detection kit for porcine epidemic diarrhea virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1 Preparation of kit of the present invention

[0038] 1. Materials and instruments

[0039] The same experimental materials and instruments as mentioned above.

[0040] 2. Experimental method

[0041] 2.1 Primer and template preparation

[0042] 2.1.1 Primer design

[0043] The LAMP primers designed for PEDV are shown in Table 1.

[0044] Primers are as follows:

[0045]

[0046] 2.1.2 Positive template preparation

[0047] The target gene fragment (SEQ ID NO: 7)

[0048] ATCTGTGAGAACCGCACTCG GATTACTCACAGCTGAGTAGTCGCCGTGTTTGGACCGGACATAGAAAGCCCAACCAGTGCCAGATGGAGCATTGACTGAACGACCAACACGTCCGTAGACAATTGTTGTAGTGGCCTTGGCGACTGTGACGAAATTAGGTAATTGACTTACCTGTACGCCAGTAGCAACCTTATAGCCCTCTACAAGCAATGTACCACTAAGGAGTGTTAGCGTTACACCAGTTGGTGCTCCAAGCACTGGAATGCAGACCTGTCGGCCCATCACAGAAGTAGTGAGAAGCGCGTCTGTTTCAGGATTGAAAGACCACCAAGAATGTGTCCTGCGCCACAACCGAATGCTATTGACAAAGTACATTATCCACAGCATAAGAGTGATGCAAGCCATAAGGATGCTGAAAGCAAAAAAGACCCAATTGACCTGAAAGCTAGCCCATGCATCAAAAAGTGACAGTGCTAACACAAG...

Embodiment 2

[0097] Embodiment 2 specificity experiment

[0098] 1. Test method

[0099] The nucleic acids of TGEV, PEDV, PoRV, CSFV, PRRSV, JEV and PRV were extracted, and the RT-LAMP detection was carried out according to the optimal conditions of Example 1 to check its specificity, and DEPC-treated water was used as a negative control.

[0100] 2. Results

[0101] Experimental results such as Figure 11-12 Adopt the method of the present invention to detect, only PEDV just has positive result, and agarose gel electrophoresis presents ladder-like band, and reaction product can be seen obvious green fluorescent reaction under ultraviolet light, and TGEV, PoRV, PEDV, CSFV, PRRSV, JEV and PRV tests were all negative, there was no ladder-like band in agarose gel electrophoresis, and the reaction product had no green fluorescence reaction under ultraviolet light.

[0102] The method of the invention can only detect PEDV virus, but not other viruses, indicating that the primers and the kit ...

Embodiment 3

[0103] Embodiment 3 Sensitivity test

[0104] 1. Test method

[0105] The prepared positive RNA template was diluted with DEPC-treated water, and the RNA concentration of PEDV was adjusted to 1.5×10 8 copies / μL, the template was diluted 10 times, and the RT-LAMP detection was performed according to the optimal conditions of Example 1, and the sensitivity test was performed, and DEPC-treated water was used as a negative control.

[0106] 2. Results

[0107] like Figures 13 to 14 As shown, the detection of positive RNA templates with 10-fold gradient dilution showed that there were obvious ladder-like bands in lanes 1-7 and the reaction products had obvious green fluorescence reactions under ultraviolet light, and RT-LAMP of PEDV could detect 10 7 The prepared positive RNA template was diluted twice, that is, 15copies / μL of the sample.

[0108] The experimental results show that the minimum detection concentration of PEDV detected by the kit of the present invention is 15 c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a kit for detecting porcine epidemic diarrhea virus. The kit comprises primers shown in SEQ ID NO:1-4, and genes used for performing loop-mediated isothermal amplification on the porcine epidemic diarrhea virus. The invention also discloses an application of the primers shown as SEQ ID NO:1-4 in preparation of agents for the genes used for performing loop-mediated isothermal amplification on the porcine epidemic diarrhea virus. The detection kit disclosed by the invention can accurately and effectively detect the porcine epidemic diarrhea virus and has the advantages of high specificity, high sensitivity, low time consumption, rapid detection and good application prospects.

Description

technical field [0001] The invention relates to a LAMP detection kit for detecting porcine epidemic diarrhea virus. Background technique [0002] The transmission rate of porcine epidemic diarrhea disease in pigs is slower than that of porcine transmissible gastroenteritis, and the mortality rate is also lower. However, in the past one or two years, it has been reported that porcine epidemic diarrhea virus (PEDV) has mutated and the mortality rate has increased . The main clinical symptoms of piglets infected with porcine epidemic diarrhea virus are: watery diarrhea accompanied by vomiting, leading to severe dehydration, weight loss, sunken eye sockets and other symptoms; Or after eating; the diseased pigs generally die in about 5 days, and the mortality rate of suckling piglets in some pig farms can be as high as 90%. The symptoms of weaned piglets and nursery pigs infected with epidemic diarrhea virus are mild, and they often show clinical symptoms such as depression, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/701
Inventor 黄小波曹三杰朱书权文心田文翼平伍锐梁恩涛段素芬张丹张小会
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products