Flowering regulatory protein HbTFL1-3 of rubber tree and encoding gene and application thereof

A technology for flowering regulation and coding genes, which can be applied in the fields of application, genetic engineering, and plant gene improvement, and can solve the problems that have not yet been reported on TFL1/CEN-like genes

Active Publication Date: 2015-11-11
RUBBER RES INST CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report about T

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Flowering regulatory protein HbTFL1-3 of rubber tree and encoding gene and application thereof
  • Flowering regulatory protein HbTFL1-3 of rubber tree and encoding gene and application thereof
  • Flowering regulatory protein HbTFL1-3 of rubber tree and encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] The acquisition of 5 target genes of embodiment 1 Hevea brasiliensis

[0032] According to the Rubber Tree Genome Database and Leaf Transcriptome Database of the Rubber Research Institute of the Chinese Academy of Tropical Agricultural Sciences, contigs obtained through homologous alignment are then spliced, and then the open reads are predicted by NCBI online software and specific primers are designed to obtain contigs containing complete open reads. DNA sequence and cDNA sequence of the reading frame.

[0033] The specific method is as follows:

[0034] Acquisition of open reading frames for 5 genes

[0035] The five gene-specific primers are as follows:

[0036] HbTFL1-1OF (EcoRI):G ATGTCAAGGATCATGGAGCC

[0037] HbTFL1-1OR(XbaI):GC TCATTCTTCTTCTTGCAGCAGTTTT

[0038] HbTFL1-2OF(EcoRI):G ATGGCAAGAATAATAGAACCTCT

[0039] HbTFL1-2OR(XbaI):GC TTAGCGCCTTCTTGCAGCAGTT

[0040] HbTFL1-3OF(EcoRI):G ATGGCAAGAATAATAGAACCTCT

[0041] HbTFL1-3OR(XbaI):GC TTAGCGT...

Embodiment 35

[0117] The spatio-temporal expression pattern analysis of embodiment 35 target genes

[0118] Taking 3 months, 2 years and 10 years as the research objects, the roots, stems, buds, bronze leaves, color-changing leaves, light green leaves and stable leaves of each age group were collected in the flowering season (March) respectively, and 10 years old. RNA was extracted from the male and female flowers of the annual tree when they bloomed.

[0119] The RNA obtained above was digested with DnaseI and then reverse transcribed according to the reverse transcription kit. The temporal and spatial expression patterns of the five target genes were analyzed by fluorescence quantitative technology.

[0120] The results showed that: in the flowering season, for TFL1-like genes, the expressions of HbTFL1-1, HbTFL1-2 and HbTFL1-33 genes in their respective vegetative organs in 10-year-old trees were significantly lower than those in 3-month-old and 2-year-old trees . In the newly differe...

Embodiment 45

[0121] Expression Analysis of Example 45 Target Genes During Inflorescence Development

[0122] The research object is the developing inflorescence. The inflorescence development is divided into 5 periods, and the division standard is the first period: the length of the inflorescence is about 0.5cm, the second period: the length of the inflorescence is about 2.0cm, the third period: the length of the inflorescence is about 4.0cm, and the fourth period: the length of the inflorescence is about 4.0cm. The first period: the length of the inflorescence is about 8.0cm, the fifth period is the flowering period, and the length of the inflorescence is > 8.0cm. Inflorescences of five stages were collected and RNA was extracted for later use.

[0123] The RNA obtained above was digested with DnaseI and then reverse transcribed according to the reverse transcription kit. The expression analysis of five target genes at different inflorescence developmental stages was carried out by fluo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a flowering regulatory protein HbTFL1-3 of a rubber tree and an encoding gene and application thereof. An amino acid sequence of the flowering regulatory protein HbTFL1-3 is as shown in SEQ ID No.9, the encoding gene of the flowering regulatory protein HbTFL1-3 is transformed for a plant, and a transgenic plant of which a flowering period is delayed can be obtained.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a rubber tree flowering regulation protein HbTFL1-3 and its encoding gene and application. Background technique [0002] TFL1 / CEN-like genes widely exist in flowering plants and are a very important flowering suppressor. They achieve the purpose of inhibiting flowering by inhibiting the downstream floral organ determination genes AP1 and LFY genes of the FT gene. [0003] In Arabidopsis tfl1 mutants, the vegetative phase of Arabidopsis is significantly shortened, concomitant with the transition of the inflorescence from an infinity to a terminal inflorescence. Therefore, it is proved that the Arabidopsis TFL1 gene has the function of simultaneously regulating vegetative growth and inflorescence development (BradleyD, RatcliffeO, VincentC, CarpenterR, CoenE (1997) InflorescencecommitmentandarchitectureinArabidopsis.Science275:80-83). In pea, two TFL1-like genes were shown to regulat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N1/21A01H5/00
CPCC07K14/415C12N15/827
Inventor 华玉伟黄华孙毕政鸿黄天带应佳志陈涛
Owner RUBBER RES INST CHINESE ACADEMY OF TROPICAL AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap