Unlock instant, AI-driven research and patent intelligence for your innovation.

Tomato ascorbic acid synthetic gene SLGPP and application thereof

A technology of ascorbic acid and synthetic genes, applied in the field of genetic engineering, to achieve the effects of promoting growth and development, increasing the content of ascorbic acid, and increasing the yield of tomatoes

Pending Publication Date: 2017-03-15
CHONGQING UNIV
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The purpose of the present invention is to provide a tomato ascorbic acid synthesis gene SLGPP and its application, aiming to solve the problem that the role of GPP gene in AsA biosynthesis belongs to a technical blank

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tomato ascorbic acid synthetic gene SLGPP and application thereof
  • Tomato ascorbic acid synthetic gene SLGPP and application thereof
  • Tomato ascorbic acid synthetic gene SLGPP and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0019] In order to make the object, technical solution and advantages of the present invention more clear, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.

[0020] The application principle of the present invention will be described in detail below in conjunction with the accompanying drawings.

[0021] The sequence of the tomato ascorbic acid synthesis gene SLGPP in the embodiment of the present invention is: SEQ ID NO:1. ATGGCACAAAATGGTTCAGTTGAACAGTTTCTTGATGTTGCAGTTGAAGCTGCTAAAAAAGCTGGAGAGATAATTCGCGAAGGATTCTACAAGACTAAGCATGTAGAGCACAAAGGAATGGTGGATTTAGTCACAGAGACTGATAAGGCATGTGAAGATTTCATTTTTAATCATCTCAAGCAACGCTTCCCCAGCCATAAGTTCATTGGTGAAGAAACAACTGCTGCTTGTGGAAACTTTGAGCTGACTGATGAACCAACTTGGATAGTTGATCCACTTGACGGAACCACTAACTTTGTGCACGGGTTCCCTTTTGTCTGTGTATCAATCGGTCTCACAATTGAAAAGAAACCAACAGTTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a tomato ascorbic acid synthetic gene SLGPP and an application thereof. The sequence of the tomato ascorbic acid synthetic gene SLGPP is SEQ ID NO:1. The SLGPP gene provided by the invention has a significant function in the growth and development process of the tomato plant; the expression of the SLGPP gene is increased and the growth and development of the tomato can be obviously promoted; the biomasses (blade weight, root weight, stalk weight, flower quantity, flowering branch quantity, flower weight and the like) of the excessive expression strains are obviously higher than those of wild strains; the quantity and weight of the fruit of the excessive expression strains are obviously higher than those of the wild strains. According to the invention, the excessively expressed tomato ascorbic acid synthetic gene GPP is used for increasing the ascorbic acid content, promoting the plant growth and increasing the tomato yield.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a tomato ascorbic acid synthesis gene SLGPP and an application thereof. Background technique [0002] Vitamin C (AsA), also known as ascorbic acid, is a powerful antioxidant that plays a very important role in protecting human health. It can remove free radicals that induce cancer and aging in the human body, increase the concentration of antibodies in the blood, enhance the immune ability of the human body, strengthen the organization of blood vessels and reduce the content of cholesterol in the blood, prevent and treat arteriosclerotic cardiovascular diseases and High blood pressure, stroke, etc., can promote the formation of collagen, make the skin firm, bones and teeth strong, and promote wound healing. Since human beings have lost the ability to synthesize ascorbic acid, they can only be supplemented through diet. Fresh fruits and vegetables are the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/55C12N9/16C12N15/10C12N15/82A01H5/00A61K48/00A61P3/02
CPCC12N9/16A61K48/005C12N15/8243
Inventor 邓伟苑瑜瑾唐雨微张文法龚泽皓梅丽华
Owner CHONGQING UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More