Linkage markers for tomato fruit firmness traits and their application

A tomato and fruit technology, applied in the direction of microbial determination/inspection, biochemical equipment and methods, DNA/RNA fragments, etc.

Active Publication Date: 2019-12-31
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no molecular markers that can be applied to the production of tomato fruit firmness traits. Therefore, it is particularly important to develop markers that can be widely used in breeding.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Linkage markers for tomato fruit firmness traits and their application
  • Linkage markers for tomato fruit firmness traits and their application
  • Linkage markers for tomato fruit firmness traits and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1, Discovery of linked markers

[0071] 1. Crossbreed tomato 'Moneymaker' and tomato LA1310 as parent materials, and obtain F10 generation RILs population consisting of 200 recombinant inbred lines by single seed propagation method.

[0072] 2. Through the resequencing of the RILs population obtained in step 1 and the genome-wide association analysis of fruit firmness-related traits, QTLs for fruit firmness-related traits were obtained, of which there were 7 QTL sites with p-5 , located within the interval of 0.2M on chromosome 10. In this interval, two pairs of applicable linkage marker primer pairs were designed and synthesized, named as linkage marker primer pair I (composed of primer L-1 and primer R-1) and linkage marker primer pair II (composed of primer L-2 and Primer R-2 composition), the primer information is shown in Table 1.

[0073] Table 1 Primer information

[0074] Primer name Primer sequence (5'-3') L-1 CTGTGACAGTCATTGTGAGCTC ...

Embodiment 2

[0075] Example 2, Establishment of a method for identifying tomato genotypes to be tested using linked marker primer pairs

[0076] 1. Extract the genomic DNA of the tomato to be tested, use the genomic DNA as a template, perform PCR amplification with primer L-1 and primer R-1, and perform agarose gel electrophoresis on the PCR amplification product.

[0077] 2. Extract the genomic DNA of the tomato to be tested, use the genomic DNA as a template, and use primer L-2 and primer R-2 to carry out PCR amplification, digest the amplified product with spe I for 8 hours, and perform agarose gelation on the digested product Gel electrophoresis.

[0078] 3. Combine the electrophoresis results of step 1 and step 2 for the following analysis:

[0079] If the PCR amplification product obtained in step 1 has a DNA fragment of 126bp and does not contain a DNA fragment of 165bp, and the enzyme digestion product obtained in step 2 has a DNA fragment of 116bp and does not have a DNA fragment...

Embodiment 3

[0082] Example 3, the application of linked marker primer pairs in judging tomato fruit firmness

[0083] 1. Select the ST059 strain (through sampling detection, all plants of the strain are MM homozygous) and the ST052 strain (through sampling detection, the strain All plants in the line were homozygous for CC).

[0084] 2. Cross the ST059 strain and the ST052 strain as parents to obtain F 1 Generation plants; the F 1 The generation plant was backcrossed with the parent ST059 strain for 3 generations, and then selfed for another generation to obtain BC 4 f 2 group.

[0085] 3. BC obtained from step 2 4 f 2 200 individual plants were randomly selected from the population, and the genomic DNA was extracted.

[0086] 4. Detection of genotype

[0087] The tomatoes to be tested were tomato 'Moneymaker', tomato LA1310 and 200 individual plants obtained in step 3.

[0088] The genotype of the tomato to be tested was detected by the method in Example 2.

[0089] When using ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a linkage mark of a tomato fruit hardness property, and an application thereof. The invention provides a primer combination. The primer combination comprises a primer pair I and a primer pair II; the primer pair I comprises a primer L-1 and a primer R-1; the primer L-1 is represented by a sequence 1 in a sequence table; the primer R-1 is represented by a sequence 2 in the sequence table; the primer pair II comprises a primer L-2 and a primer R-2; the primer L-2 is represented by a sequence 3 in the sequence table; and the primer R-2 is represented by a sequence 4 in the sequence table. The linkage marker of the tomato fruit hardness is developed by using a molecular marker assisted breeding method for the first time. A high hardness tomato fruit variety is selected and bred by using the fruit hardness-related linkage marker and can be identified in the tomato seedling stage without phenotype detection after tomato fruiting, so the identification is completed early, the unnecessary planting area is reduced, and the consumption of manpower and material resources is reduced.

Description

technical field [0001] The invention relates to a linkage marker of tomato fruit firmness traits and its application. Background technique [0002] Tomato is an important vegetable crop widely produced and consumed in the world. Tomato fruit firmness is an important factor to evaluate the quality of a tomato variety. Fruit firmness is directly related to fruit pressure resistance and peel puncture resistance, which affects many important quality indicators such as storage and transportation resistance, shelf life and taste of tomato fruit. Especially for processing tomatoes, after the raw materials are harvested, they need to go through a long period of transportation and queuing for sale before entering the processing plant. During this process, varieties with poor hardness are prone to fruit rupture, juice leakage, and even The mildew and rot caused a large number of fruits, which affected the quality of tomatoes and caused farmers to suffer huge economic losses. Therefo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/11C12Q1/6895
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor崔霞李仁孙帅张率斌
OwnerINST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI