Unlock instant, AI-driven research and patent intelligence for your innovation.

Linkage Marker and Application of Glandular Hair Traits in Tomato

A technology of tomato and glandular trichomes, which is applied in the field of linkage markers of tomato glandular trichomes, to achieve the effects of reducing the consumption of manpower and material resources, early identification time, and shortening the planting area

Active Publication Date: 2019-11-01
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no molecular markers that can be applied to the production of tomato glandular trichome density. Therefore, it is particularly important to develop markers that can be widely used in breeding.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Linkage Marker and Application of Glandular Hair Traits in Tomato
  • Linkage Marker and Application of Glandular Hair Traits in Tomato

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1, Discovery of linked markers

[0056] 1. Crossbreed tomato 'Moneymaker' and gooseberry tomato Solanum pimpinellifolium as parents, and obtain F consisting of 200 recombinant inbred lines according to the single-seed method 10 generation of RILs groups.

[0057]2. Through the resequencing of the RILs population obtained in step 1 and the genome-wide association analysis of glandular hair-related traits, a QTLs (p value 5.94E-18) for glandular hair-related traits was obtained, located at the 39kb region of chromosome 10 within the range. A pair of applicable linked marker primer pairs (consisting of primer F and primer R) were designed and synthesized within this interval, and the primer information is shown in Table 1.

[0058] Table 1 Primer information

[0059] Primer name Primer sequence (5'-3') F AAATTGGACAATTGGTCCAC (SEQ ID NO: 1 of the SEQUENCE LISTING) R GAGCAAATCCCTACTACTTTTG (SEQ ID NO: 2 of the Sequence Listing)

Embodiment 2

[0060] Example 2, Establishment of a method for identifying tomato genotypes to be tested using linked marker primer pairs

[0061] Genomic DNA of the tomato to be tested was extracted, and the genomic DNA was used as a template to carry out PCR amplification with primer F and primer R, and the PCR amplification product was subjected to agarose gel electrophoresis.

[0062] If the PCR amplification product has a DNA fragment of 171bp and does not contain a DNA fragment of 193bp, the plant to be tested is defined as MM homozygous;

[0063] If the PCR amplification product has a DNA fragment of 193bp and does not have a DNA fragment of 171bp, the plant to be tested is defined as PP homozygous.

[0064] Tomato ‘Moneymaker’ and gooseberry tomato Solanum pimpinellifolium were identified by the above method. Tomato ‘Moneymaker’ was homozygous for MM, and gooseberry tomato Solanum pimpinellifolium was homozygous for PP.

Embodiment 3

[0065] Example 3, the application of linked marker primer pairs in judging the traits of tomato glandular hairs

[0066] 1. Select SL021 strain (through sampling detection, all plants of this strain are MM homozygous) and SL134 strain (through sampling detection, all plants of this strain) from the recombinant inbred line RILs population that embodiment 1 builds All were homozygous for PP).

[0067] 2. Cross the SL021 strain and the SL134 strain as parents to obtain F 1 Generation plants; the F 1 The generation plants were backcrossed with the parent SL021 strain for 3 generations, and then selfed for one generation to obtain BC 4 f 2 group.

[0068] 3. BC obtained from step 2 4 f 2 85 individual plants were randomly selected from the population, and the genomic DNA was extracted.

[0069] 4. Detection of genotype

[0070] The tomatoes to be tested were tomato 'Moneymaker', gooseberry tomato Solanum pimpinellifolium and 85 individual plants obtained in step 3.

[0071...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a linked marker of tomato glandular hair character and application thereof. A specific primer pair is claimed, and consists of a primer F and a primer R, wherein the primer F is a single-chain DNA (deoxyribonucleic acid) molecule shown in a sequence 1 in a sequence table; the primer R is a single-chain DNA molecule shown in a sequence 2 in the sequence table. The application of the specific primer pair in identifying or auxiliary identifying of the tomato glandular hair character is also claimed. The specific primer has the advantages that when a insect-resistant tomato variety with higher glandular hair density is bred, the glandular hair character can be identified in a seedling phase of tomato, a phenotype can be measured without waiting for planting, the identifying time is greatly shortened, the unnecessary planting area is reduced, and the consumption of labor and material is decreased.

Description

technical field [0001] The invention relates to a linkage marker of tomato glandular hair traits and its application. Background technique [0002] Tomato is an important vegetable crop that is widely produced and consumed in the world, and it often suffers from various pests and diseases during its growth and development. Glandular trichomes and their secondary metabolites of tomato are closely related to their defense against insects. Glandular trichome secretions exhibit repellent and poisonous effects on a variety of herbivorous insects. Therefore, the use of molecular marker-assisted breeding to select tomato varieties with denser glandular hairs is of great significance for increasing tomato yield and reducing the amount of pesticides used. [0003] The traditional method mainly relies on the naked eye to identify the density of glandular hairs, but this method has great limitations. The glandular trichome density of most tomato varieties has no significant differenc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 崔霞张率斌徐萌李仁
Owner INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI