Application of a group of gene mutation sites in the preparation of reagents or kits for diagnosing chronic pancreatitis and evaluating prognosis

A chronic pancreatitis and reagent kit technology, applied in the field of biotechnology and medical diagnosis, can solve the problems of lack and inability to fully reflect the real situation of pathogenic mutations, and achieve the effects of high throughput, shortened research cycle, and high data accuracy

Active Publication Date: 2020-08-07
SHANGHAI CHANGHAI HOSPITAL
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is currently a lack of genetic data on CP in my country, and only a small sample of sequencing results for a certain gene can not fully reflect the true situation of pathogenic mutations in CP in my country

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a group of gene mutation sites in the preparation of reagents or kits for diagnosing chronic pancreatitis and evaluating prognosis
  • Application of a group of gene mutation sites in the preparation of reagents or kits for diagnosing chronic pancreatitis and evaluating prognosis
  • Application of a group of gene mutation sites in the preparation of reagents or kits for diagnosing chronic pancreatitis and evaluating prognosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] 1. Multiplex PCR primer design

[0048] Use Primer3 (http: / / simgene.com / Primer3) to design 26 gene coding sequences and exon / intron regions, and the 5' ends of the primers are synthesized using common linker sequences, that is, all 5' end primers contain CS1 (5 '-ACACTGACGACATGGTTCTACA-3'), all 3' primers contained CS2 (5'-TACGGTAGCAGAGACTTGGTCT-3'), all primers and some other primer pairs were divided into two multiplex primer pools (Table 2).

[0049] Table 2 List of primers for targeted sequencing of all exons of SPINK1, PRSS1 and CTRC

[0050]

[0051]

[0052]

[0053] 2. Pre-amplification of labeled gene amplicons

[0054] The labeled amplicons are first amplified in two multiplex PCR reactions as follows:

[0055]

[0056] The PCR reaction conditions are as follows:

[0057]

[0058] Treat the above 2.5μl PCR product as follows:

[0059]

[0060] First process at 37°C for 60min, then mix at 80°C for 20min. The processed samples were diluted...

Embodiment 2

[0071] Statistical analysis was used to evaluate the performance of single mutation detection and combined detection of 6 mutations. As shown in Table 3, c.101A>G, c.194+2T>C, c.346C>T, c.365G>A, c.623G>C, c.180C>T mutations alone were used to detect chronic pancreas The sensitivities of inflammation were 2.2%, 37.6%, 1.3%, 2.2%, 8.6%, 1.8%, 46.1%, respectively, and the sensitivity of combined detection of chronic pancreatitis was 46.1%, which were significantly higher than those of the single mutation detection group (p <0.001).

[0072] Table 3 The results of individual detection of 6 mutations and joint detection in patients with chronic pancreatitis

[0073]

[0074] All mutations were verified by PCR-sequencing method, and the PCR reaction system was carried out using HotStarTaq enzyme (Qiagen, Germany), as follows:

[0075]

[0076] 1) For c.101A>G, c.194+2T>C on the SPINK1 gene:

[0077] The detection forward primer used is CCAATCACAGTTATTTCCCCAGAG (SEQ ID NO.1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of biotechnology and medical diagnosis, in particular to application of a set of pathogenic gene mutation sites associated with CP, and application of the gene mutation sites in preparation of a reagent or kit for diagnosing or treating CP and evaluating prognosis. The application of a set of the gene mutation sites in the preparation of the reagent or the kit for diagnosing CP and evaluating the prognosis disclosed by the invention has the advantages of finding the names and frequency of six common pathogenic mutations of CP in China, and having the total carrying frequency as high as 46.1%, and the invention further discloses that the pathogenic mutations have the effect of accelerating the occurrence and progression speed of CP clinical course to provide a scientific basis for the next clinical early diagnosis and making of individualized therapeutic schemes.

Description

technical field [0001] The present invention relates to the field of biotechnology and medical diagnosis, specifically, a group of chronic pancreatitis (chronicpancreatitis, CP) related disease-causing gene mutation sites, and these gene mutation sites are used in the preparation of reagents for diagnosing CP, evaluating prognosis or application in the kit. Background technique [0002] Chronic pancreatitis (CP) refers to an irreversible chronic inflammatory disease of pancreatic tissue and function caused by various etiologies. (Endocrine insufficiency) is the main manifestation, seriously affecting the quality of life of patients. The specific pathogenesis of CP is still unclear, and whether patients develop symptoms depends on a certain degree of genetic risk factors and exogenous stimuli (especially alcohol consumption). The incidence of CP in my country is increasing year by year, and its etiology is complex, mainly including heavy drinking, genetic factors, bile-panc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/118C12Q2600/156
Inventor邹文斌廖专李兆申唐欣颖陈佳云
OwnerSHANGHAI CHANGHAI HOSPITAL