Application of rice cyc U2;1 gene in controlling rice mesocotyl development
A rice and hypocotyl technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of decreased seedling emergence rate, decreased yield, difficulty in emergence of rice seed top soil, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Acquisition of a gene CYC U2;1 controlling rice mesocotyl development:
[0023] The inventor cloned CYC U2; 1 from rice mesocotyls by means of reverse genetics, and used Real-time PCT to verify the specific expression of CYCU2; 1 in the mesocotyl. The specific steps include:
[0024] Cloning of gene CYC U2;1:
[0025] The total volume of the reaction system is 50 μl, the template is Nipponbare cDNA 1ul (about 50ng), 10×KOD enzyme reaction buffer 5μl, 25mM MgCL 2 2μl, 5mM dNTP 5μl, 5uM primer 5μl (by step PCR method, use primers CYC U2-1306-F and CYC U2-1306-R (each primer is 2.5μl), 1μl KOD enzyme, add ddH 2 O (sterile deionized water) to 50 μl.
[0026] The reaction program was: denaturation at 94°C for 5min, 30s at 94°C, 1min at 55°C, 35cycles at 68°C for 2min, and extension at 68°C for 10min.
[0027] The primers used are as follows:
[0028] CYC U2-1306-F: CGGGATCCATGGCGTCCACTGAGTTAGCGTCGG
[0029] CYC U2-1306-R:GCTCTAGACTGGGCTGCCGCCGACGCCGCTTGC
[0030] Fina...
Embodiment 2
[0034] The application of CYC U2; 1 gene in controlling rice mesocotyl, the application process is as follows:
[0035] 1) Construction of plant expression vector pCYCU2; 1-GUS
[0036] Amplify the CYC U2;1 promoter region and clone the fragment into pCAMBIA1300GNGUS using the MfeI / KpnI restriction site (Ren Z H, Gao J P, Li L G, et al. A rice quantitative trait locus for salttolerance encodes a sodium transporter[J] .Nature genetics, 2005,37(10):1141-1146.) on the carrier.
[0037] The CYC U2; 1 promoter region is obtained in the following manner:
[0038] The total volume of the reaction system is 50 μl, the template is Nipponbare Genomic DNA 1ul (about 50ng), 1×KOD enzyme reaction buffer 5μl, 25mM MgCL 2 2μl, 5mM dNTP 5μl, 5uM primer 5μl (primers CYC U2Pro-F and CYC U2Pro-R respectively 2.5μl), 1μl KOD enzyme, add ddH 2O (sterile deionized water) to 50 μl. The reaction program was: denaturation at 94°C for 5min, 30s at 94°C, 1min at 55°C, 35cycles at 68°C for 2min, and...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



