GLI2-shRNA and application thereof

A technology of use and nucleotide sequence, applied in the field of GLI2-shRNA
CN109735543AActive Publication Date: 2019-05-10SICHUAN UNIV
1 Cites 1 Cited by

Patent Information

Authority / Receiving Office
CN ยท China
Patent Type
Applications(China)
Current Assignee / Owner
SICHUAN UNIV
Publication Date
2019-05-10

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses GLI2-shRNA and application thereof. The GLI2-shRNA has the nucleotide sequence of GATCCGTGTGGAGGACTGCCTACA TATTTCAAGAGAATATGTAGGCAGTCCTCCACATTTTTTATGTTTTTTA. The invention further discloses a carrier, a host and application. The expression of GLI2mRNA and proteins can be effectively reduced, the expression of intrahepatic biliary epithelial cells E-cadherin can be up-regulated, the expression level of Vim and alpha-SMA proteins is down-regulated, and therefore the epithelial mesenchymal transformation of the biliary epithelial cells is reversed.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention relates to the field of biomedicine, in particular to a GLI2-shRNA and its application. Background technique

[0002] Biliary atresia is an inflammatory sclerosing cholangiopathy, which is the main disease leading to liver transplantation in children. Epithelial-mesenchymal transition (EMT) of biliary epithelial cells is one of the main pathological processes leading to liver fibrosis. Studies have shown that EMT plays an important role in embryonic development, tissue regeneration and repair, organ fibrosis, and cancer cell metastasis. After many tissues and organs are injured, fibrous tissue and scar tissue are formed through the EMT mechanism to achieve wound repair, but the persistence of this process can cause tissue and organ fibrosis and sclerosis, such as pulmonary fibrosis and kidney fibrosis. The Shh signaling pathway plays an important role in embryonic development, epithelial-mesenchymal and epithelial-epithelial signal trans...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More