Unlock instant, AI-driven research and patent intelligence for your innovation.

GLI2-shRNA and application thereof

A technology of use and nucleotide sequence, applied in the field of GLI2-shRNA

Active Publication Date: 2019-05-10
SICHUAN UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are currently no relevant literatures on genes that silence Gli2 mRNA and protein expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GLI2-shRNA and application thereof
  • GLI2-shRNA and application thereof
  • GLI2-shRNA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] 1 Gene synthesis and viral vector construction

[0026] The general steps are as follows:

[0027] The first step, sequence design

[0028] According to the GLI2 CDS sequence, a silencing sequence specifically recognizing GLI2 was designed on the homepage of Invitrogen Company with corresponding software and synthesized by existing techniques.

[0029] The second step is to perform double enzyme digestion on the target sequence and expression vector

[0030] The synthesized target sequence and the pLent-U6-Puro vector were double digested, and the target sequence and linear vector were recovered using a gel recovery kit.

[0031] The third step is to connect the target sequence to the vector

[0032] The two products in the previous step were ligated, transformed and extracted under the action of T4DNA ligase to obtain the silencing vector GLI2-shRNA.

[0033] The fourth step, lentiviral packaging

[0034] The silencing vector obtained in the previous step was tran...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses GLI2-shRNA and application thereof. The GLI2-shRNA has the nucleotide sequence of GATCCGTGTGGAGGACTGCCTACA TATTTCAAGAGAATATGTAGGCAGTCCTCCACATTTTTTATGTTTTTTA. The invention further discloses a carrier, a host and application. The expression of GLI2mRNA and proteins can be effectively reduced, the expression of intrahepatic biliary epithelial cells E-cadherin can be up-regulated, the expression level of Vim and alpha-SMA proteins is down-regulated, and therefore the epithelial mesenchymal transformation of the biliary epithelial cells is reversed.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a GLI2-shRNA and its application. Background technique [0002] Biliary atresia is an inflammatory sclerosing cholangiopathy, which is the main disease leading to liver transplantation in children. Epithelial-mesenchymal transition (EMT) of biliary epithelial cells is one of the main pathological processes leading to liver fibrosis. Studies have shown that EMT plays an important role in embryonic development, tissue regeneration and repair, organ fibrosis, and cancer cell metastasis. After many tissues and organs are injured, fibrous tissue and scar tissue are formed through the EMT mechanism to achieve wound repair, but the persistence of this process can cause tissue and organ fibrosis and sclerosis, such as pulmonary fibrosis and kidney fibrosis. The Shh signaling pathway plays an important role in embryonic development, epithelial-mesenchymal and epithelial-epithelial signal trans...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/867A61K31/7105A61P1/16
Inventor 靳曙光
Owner SICHUAN UNIV